Transcript: Human NM_001145154.3

Homo sapiens dynein axonemal heavy chain 14 (DNAH14), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
DNAH14 (127602)
Length:
2291
CDS:
195..1556

Additional Resources:

NCBI RefSeq record:
NM_001145154.3
NBCI Gene record:
DNAH14 (127602)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145154.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000268617 GTATCGGCTCATACTGCTAAA pLKO_005 780 CDS 100% 10.800 15.120 N DNAH14 n/a
2 TRCN0000268616 GCTTGGTTGGCAAACTATATT pLKO_005 611 CDS 100% 15.000 10.500 N DNAH14 n/a
3 TRCN0000268615 GAGACTCAACCAGCTGAAATA pLKO_005 318 CDS 100% 13.200 9.240 N DNAH14 n/a
4 TRCN0000268661 GCAATTCAGAAGATTACTTTA pLKO_005 669 CDS 100% 13.200 9.240 N DNAH14 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145154.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13131 pDONR223 100% 96.6% 96.6% None 1_45del n/a
2 ccsbBroad304_13131 pLX_304 0% 96.6% 96.6% V5 1_45del n/a
3 TRCN0000474222 GACTCCGTATCCCGATTCGTATAC pLX_317 43.3% 96.6% 96.6% V5 1_45del n/a
Download CSV