Transcript: Mouse NM_001145162.1

Mus musculus ubiquitin-conjugating enzyme E2Q family-like 1 (Ube2ql1), mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ube2ql1 (76980)
Length:
2711
CDS:
558..1472

Additional Resources:

NCBI RefSeq record:
NM_001145162.1
NBCI Gene record:
Ube2ql1 (76980)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001145162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000092482 CCGCTTCATCTCGGTGGAGCT pLKO.1 1022 CDS 100% 0.000 0.000 N Ube2ql1 n/a
2 TRCN0000092478 CGACATAACTTGAAGATGTAT pLKO.1 1927 3UTR 100% 5.625 3.938 N Ube2ql1 n/a
3 TRCN0000092480 TGAAGCAACCTTTAAGAGTTT pLKO.1 1397 CDS 100% 4.950 3.465 N Ube2ql1 n/a
4 TRCN0000092481 GAGGCCGTCATGCGCCAGTTT pLKO.1 1296 CDS 100% 0.000 0.000 N Ube2ql1 n/a
5 TRCN0000092479 GCCGCAAGGAAGCTGAAGCAA pLKO.1 1384 CDS 100% 1.000 0.600 N Ube2ql1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145162.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.