Transcript: Human NM_001145165.2

Homo sapiens deoxyhypusine hydroxylase (DOHH), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-15
Taxon:
Homo sapiens (human)
Gene:
DOHH (83475)
Length:
1763
CDS:
187..1095

Additional Resources:

NCBI RefSeq record:
NM_001145165.2
NBCI Gene record:
DOHH (83475)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145165.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243284 CGCAGAGCTTTGGCGTCTAAA pLKO_005 1149 3UTR 100% 13.200 18.480 N DOHH n/a
2 TRCN0000243285 CCAGGCCTTCGATGACGATTC pLKO_005 318 CDS 100% 2.000 2.800 N DOHH n/a
3 TRCN0000243282 AGGTGGCTCTGGACATGTATG pLKO_005 1007 CDS 100% 10.800 7.560 N DOHH n/a
4 TRCN0000243286 GGAGATCCTGAAGCAGTATTC pLKO_005 498 CDS 100% 10.800 7.560 N DOHH n/a
5 TRCN0000243283 CAGGCGCCATTGCATGGATCA pLKO_005 296 CDS 100% 1.350 0.945 N DOHH n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145165.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04273 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_04273 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000467664 CTCTTTCTAGTGCCTTTGCTTAAG pLX_317 43.5% 100% 100% V5 n/a
Download CSV