Transcript: Human NM_001145196.1

Homo sapiens SPATA31 subfamily A member 6 (SPATA31A6), mRNA.

Source:
NCBI, updated 2019-05-01
Taxon:
Homo sapiens (human)
Gene:
SPATA31A6 (389730)
Length:
4214
CDS:
30..4061

Additional Resources:

NCBI RefSeq record:
NM_001145196.1
NBCI Gene record:
SPATA31A6 (389730)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145196.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000352349 TCCCACCGCCAACCCTTTATT pLKO_005 1446 CDS 100% 15.000 10.500 N SPATA31A6 n/a
2 TRCN0000352374 GCACCATGCCTCGAAGGTAAA pLKO_005 3695 CDS 100% 10.800 6.480 N SPATA31A6 n/a
3 TRCN0000352439 GACTCGGGAAGTGATTTATTA pLKO_005 2151 CDS 100% 15.000 7.500 Y SPATA31A6 n/a
4 TRCN0000269662 GTGACTCGGGAAGTGATTTAT pLKO_005 2149 CDS 100% 15.000 7.500 Y SPATA31A3 n/a
5 TRCN0000371108 ATGCACAGAGAGGACTCATAT pLKO_005 2174 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
6 TRCN0000371109 CAAGCCCATTCAGTGCTTTAA pLKO_005 2477 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
7 TRCN0000352398 CAGAACCTCGTGCGCCTTTAA pLKO_005 890 CDS 100% 13.200 6.600 Y SPATA31A6 n/a
8 TRCN0000269765 CATGACGGCAGTTGGACAAAT pLKO_005 3644 CDS 100% 13.200 6.600 Y SPATA31A5 n/a
9 TRCN0000269421 CTTGCCCTGCATCGCAGAATA pLKO_005 1588 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
10 TRCN0000371051 GAGTGACTCGGGAAGTGATTT pLKO_005 2147 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
11 TRCN0000284087 GCACAGAGAGGACTCATATAG pLKO_005 2176 CDS 100% 13.200 6.600 Y SPATA31A5 n/a
12 TRCN0000352417 GGGTAACTGACAGGTCTTATA pLKO_005 1324 CDS 100% 13.200 6.600 Y SPATA31A6 n/a
13 TRCN0000269663 GGTAACTGACAGGTCTTATAC pLKO_005 1325 CDS 100% 13.200 6.600 Y SPATA31A3 n/a
14 TRCN0000269495 TGCACAGAGAGGACTCATATA pLKO_005 2175 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
15 TRCN0000344441 TGCGGGACTCCACACTGATAA pLKO_005 715 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
16 TRCN0000269443 TGGGTAACTGACAGGTCTTAT pLKO_005 1323 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
17 TRCN0000269475 ACTTAGTGCCTCATCGCTAAA pLKO_005 59 CDS 100% 10.800 5.400 Y SPATA31A1 n/a
18 TRCN0000269494 AGTCTAGGAAGCCCAACTTAG pLKO_005 3352 CDS 100% 10.800 5.400 Y SPATA31A1 n/a
19 TRCN0000269505 CTTAGTGCCTCATCGCTAAAC pLKO_005 60 CDS 100% 10.800 5.400 Y SPATA31A1 n/a
20 TRCN0000269711 TCTTATGGAGGAGGTTGTTAG pLKO_005 3029 CDS 100% 10.800 5.400 Y SPATA31A3 n/a
21 TRCN0000144768 CAGGAAAGTTTGACATCCATT pLKO.1 1749 CDS 100% 4.950 2.475 Y SPATA31A7 n/a
22 TRCN0000142540 GCCCAATTCAAAGGGAGACTA pLKO.1 1390 CDS 100% 4.950 2.475 Y SPATA31A7 n/a
23 TRCN0000141870 GCTTGTCTCCACATGAGGATT pLKO.1 787 CDS 100% 4.950 2.475 Y SPATA31A7 n/a
24 TRCN0000143757 CCAGGAAAGTTTGACATCCAT pLKO.1 1748 CDS 100% 3.000 1.500 Y SPATA31A7 n/a
25 TRCN0000142675 CACATGAGGATTTGGTGGCTT pLKO.1 796 CDS 100% 2.640 1.320 Y SPATA31A7 n/a
26 TRCN0000143834 CACCTTGACAAAGGTGACTTT pLKO.1 351 CDS 100% 0.495 0.248 Y SPATA31A7 n/a
27 TRCN0000269420 TCTTATGGAGGAGGTTGTTAA pLKO_005 3029 CDS 100% 13.200 6.600 Y SPATA31A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145196.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.