Transcript: Human NM_001145268.2

Homo sapiens family with sequence similarity 185 member A (FAM185A), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-02
Taxon:
Homo sapiens (human)
Gene:
FAM185A (222234)
Length:
2211
CDS:
210..1388

Additional Resources:

NCBI RefSeq record:
NM_001145268.2
NBCI Gene record:
FAM185A (222234)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000164171 CCACTCAAGGAAAGGAGATTA pLKO.1 2051 3UTR 100% 13.200 9.240 N FAM185A n/a
2 TRCN0000166552 CCCACTCAAGGAAAGGAGATT pLKO.1 2050 3UTR 100% 4.950 3.465 N FAM185A n/a
3 TRCN0000163185 GCTGAGTTCTTCTCATGCTTT pLKO.1 1880 3UTR 100% 4.950 3.465 N FAM185A n/a
4 TRCN0000158865 GCTTTGAATATCTGACTTCTT pLKO.1 1896 3UTR 100% 4.950 2.970 N FAM185A n/a
5 TRCN0000165245 GATGGCCATTGTGTCTGATAC pLKO.1 593 CDS 100% 10.800 5.400 Y FAM185A n/a
6 TRCN0000163006 GCCATTGTGTCTGATACTATC pLKO.1 597 CDS 100% 10.800 5.400 Y FAM185A n/a
7 TRCN0000165521 GAGATGGCCATTGTGTCTGAT pLKO.1 591 CDS 100% 4.950 2.475 Y FAM185A n/a
8 TRCN0000159862 GCCAAGTATCTTTATACAGAA pLKO.1 930 CDS 100% 4.950 2.475 Y FAM185A n/a
9 TRCN0000164287 CCATCTTCACTTCAAGCTCAT pLKO.1 1161 CDS 100% 4.050 2.025 Y FAM185A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145268.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13434 pDONR223 100% 36.5% 36.4% None 179G>C;432_1176delinsT n/a
2 ccsbBroad304_13434 pLX_304 0% 36.5% 36.4% V5 179G>C;432_1176delinsT n/a
Download CSV