Transcript: Human NM_001145288.2

Homo sapiens solute carrier family 17 member 8 (SLC17A8), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-08-09
Taxon:
Homo sapiens (human)
Gene:
SLC17A8 (246213)
Length:
3834
CDS:
319..1938

Additional Resources:

NCBI RefSeq record:
NM_001145288.2
NBCI Gene record:
SLC17A8 (246213)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145288.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435623 TGCGCTCAGTTGATAACATAG pLKO_005 2113 3UTR 100% 10.800 15.120 N SLC17A8 n/a
2 TRCN0000043231 GCTATCTCCTTTCTGGTACTT pLKO.1 1414 CDS 100% 4.950 6.930 N SLC17A8 n/a
3 TRCN0000043228 CGTGGGAGATTCTTTGGGAAT pLKO.1 390 CDS 100% 4.050 5.670 N SLC17A8 n/a
4 TRCN0000043229 GCACCGTATATGTTGATGGAA pLKO.1 638 CDS 100% 3.000 4.200 N SLC17A8 n/a
5 TRCN0000426340 GAGGACAATTGGCTGATTATT pLKO_005 1277 CDS 100% 15.000 12.000 N SLC17A8 n/a
6 TRCN0000426144 TCATTGACCAGGACGAATTAG pLKO_005 1733 CDS 100% 13.200 9.240 N SLC17A8 n/a
7 TRCN0000043230 GCGTTACATCATTGCTATCAT pLKO.1 540 CDS 100% 5.625 3.938 N SLC17A8 n/a
8 TRCN0000043232 GTCCAGAAGAAGGAATGGAAA pLKO.1 1837 CDS 100% 4.950 2.970 N SLC17A8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145288.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05283 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05283 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473415 TGCGATAGCCCATGGCGGTGGTCG pLX_317 19% 100% 100% V5 n/a
Download CSV