Transcript: Human NM_001145295.1

Homo sapiens N-glycanase 1 (NGLY1), transcript variant 4, mRNA.

Source:
NCBI, updated 2019-08-03
Taxon:
Homo sapiens (human)
Gene:
NGLY1 (55768)
Length:
2421
CDS:
109..1785

Additional Resources:

NCBI RefSeq record:
NM_001145295.1
NBCI Gene record:
NGLY1 (55768)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145295.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304166 ATTACTTCGAGACACTATTAA pLKO_005 1332 CDS 100% 15.000 21.000 N NGLY1 n/a
2 TRCN0000304229 CCACCCTGTGCTAGCATATTT pLKO_005 1982 3UTR 100% 15.000 21.000 N NGLY1 n/a
3 TRCN0000370501 TATCTTTATACGTGGACTATA pLKO_005 2041 3UTR 100% 13.200 18.480 N NGLY1 n/a
4 TRCN0000304238 TTGATGTCACTTGGCGATATT pLKO_005 1262 CDS 100% 13.200 10.560 N NGLY1 n/a
5 TRCN0000118218 GCTCCACCTTTGTTACAATAT pLKO.1 1584 CDS 100% 13.200 9.240 N NGLY1 n/a
6 TRCN0000370500 AGATCGTTATGTTCGAGTTTC pLKO_005 1611 CDS 100% 10.800 7.560 N NGLY1 n/a
7 TRCN0000118221 CTTTCCTATGTCATAGCATTT pLKO.1 1225 CDS 100% 10.800 7.560 N NGLY1 n/a
8 TRCN0000118217 GCTGGCAATAATCAAGGACTT pLKO.1 1917 3UTR 100% 4.050 2.835 N NGLY1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145295.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03651 pDONR223 100% 85.3% 81.5% None 1610_1611ins178;1674_1675ins110 n/a
2 ccsbBroad304_03651 pLX_304 0% 85.3% 81.5% V5 1610_1611ins178;1674_1675ins110 n/a
3 TRCN0000472129 TATAAATTGAGAACTGTCATTTCC pLX_317 21.3% 85.3% 81.5% V5 1610_1611ins178;1674_1675ins110 n/a
Download CSV