Transcript: Human NM_001145413.3

Homo sapiens nuclear factor, erythroid 2 like 2 (NFE2L2), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-09-16
Taxon:
Homo sapiens (human)
Gene:
NFE2L2 (4780)
Length:
2967
CDS:
733..2481

Additional Resources:

NCBI RefSeq record:
NM_001145413.3
NBCI Gene record:
NFE2L2 (4780)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145413.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273552 CTTGCATTAATTCGGGATATA pLKO_005 2146 CDS 100% 13.200 18.480 N NFE2L2 n/a
2 TRCN0000007558 CCGGCATTTCACTAAACACAA pLKO.1 1694 CDS 100% 4.950 6.930 N NFE2L2 n/a
3 TRCN0000284999 CCGGCATTTCACTAAACACAA pLKO_005 1694 CDS 100% 4.950 6.930 N NFE2L2 n/a
4 TRCN0000007557 CCCTGTTGATTTAGACGGTAT pLKO.1 1182 CDS 100% 4.050 5.670 N NFE2L2 n/a
5 TRCN0000281950 AGAGCAAGATTTAGATCATTT pLKO_005 2238 CDS 100% 13.200 9.240 N NFE2L2 n/a
6 TRCN0000273494 AGTTTGGGAGGAGCTATTATC pLKO_005 1221 CDS 100% 13.200 9.240 N NFE2L2 n/a
7 TRCN0000007555 GCTCCTACTGTGATGTGAAAT pLKO.1 2537 3UTR 100% 13.200 9.240 N NFE2L2 n/a
8 TRCN0000284998 GCTCCTACTGTGATGTGAAAT pLKO_005 2537 3UTR 100% 13.200 9.240 N NFE2L2 n/a
9 TRCN0000007556 GCACCTTATATCTCGAAGTTT pLKO.1 2336 CDS 100% 5.625 3.938 N NFE2L2 n/a
10 TRCN0000007559 GCAGCAAACAAGAGATGGCAA pLKO.1 2412 CDS 100% 2.640 1.848 N NFE2L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145413.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01090 pDONR223 100% 96.1% 96.1% None 0_1ins48;352_353ins21 n/a
2 ccsbBroad304_01090 pLX_304 0% 96.1% 96.1% V5 0_1ins48;352_353ins21 n/a
3 TRCN0000480103 GTGAATTTATGTCTCTATTTATTG pLX_317 23.1% 96.1% 96.1% V5 0_1ins48;352_353ins21 n/a
Download CSV