Transcript: Human NM_001145440.3

Homo sapiens tRNA-yW synthesizing protein 1 homolog B (TYW1B), mRNA.

Source:
NCBI, updated 2019-08-11
Taxon:
Homo sapiens (human)
Gene:
TYW1B (441250)
Length:
3117
CDS:
126..2132

Additional Resources:

NCBI RefSeq record:
NM_001145440.3
NBCI Gene record:
TYW1B (441250)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145440.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000337100 AGCAATTCCTTGACAGTTTAA pLKO_005 1594 CDS 100% 13.200 9.240 N TYW1B n/a
2 TRCN0000337171 GTCATCGAGATGCAGGGATTT pLKO_005 246 CDS 100% 10.800 7.560 N TYW1B n/a
3 TRCN0000337099 AGCTTGGCGTGTGCTAATAAA pLKO_005 1170 CDS 100% 15.000 7.500 Y TYW1B n/a
4 TRCN0000337169 AGGACCATCAGAGCCTAAATT pLKO_005 895 CDS 100% 15.000 7.500 Y TYW1B n/a
5 TRCN0000337173 CTCCGAGAAGCCCTTACTAAA pLKO_005 1065 CDS 100% 13.200 6.600 Y TYW1B n/a
6 TRCN0000056648 CCTCCTGATAGCACACAGAAA pLKO.1 1889 CDS 100% 4.950 2.475 Y TYW1 n/a
7 TRCN0000290054 CCTCCTGATAGCACACAGAAA pLKO_005 1889 CDS 100% 4.950 2.475 Y TYW1 n/a
8 TRCN0000056651 CCCGAATATGAAATTGCATGT pLKO.1 1848 CDS 100% 4.050 2.025 Y TYW1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145440.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05678 pDONR223 100% 99.9% 99.8% None 1532T>C n/a
2 ccsbBroad304_05678 pLX_304 0% 99.9% 99.8% V5 1532T>C n/a
3 TRCN0000474336 TGCAGATAATATTTTCCCCCAGTC pLX_317 20.1% 99.9% 99.8% V5 1532T>C n/a
Download CSV