Transcript: Human NM_001145465.1

Homo sapiens NANOG neighbor homeobox (NANOGNB), mRNA.

Source:
NCBI, updated 2019-06-30
Taxon:
Homo sapiens (human)
Gene:
NANOGNB (360030)
Length:
907
CDS:
71..637

Additional Resources:

NCBI RefSeq record:
NM_001145465.1
NBCI Gene record:
NANOGNB (360030)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145465.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418958 ATCGCACTGGCTAAGACATTT pLKO_005 685 3UTR 100% 13.200 18.480 N NANOGNB n/a
2 TRCN0000017986 CAGAAACAGTATCCCGAGAAA pLKO.1 368 CDS 100% 4.950 6.930 N NANOGNB n/a
3 TRCN0000017983 CCAGAACAATCAACTGGAAAT pLKO.1 203 CDS 100% 10.800 7.560 N NANOGNB n/a
4 TRCN0000017984 GCATACTCTCTGGGCAAAGTT pLKO.1 412 CDS 100% 5.625 3.938 N NANOGNB n/a
5 TRCN0000414222 GGAGTTCTGAAAGGATAAACA pLKO_005 733 3UTR 100% 5.625 3.938 N NANOGNB n/a
6 TRCN0000017985 GTCCAAGAGAAAGCATAAGAA pLKO.1 553 CDS 100% 5.625 3.938 N NANOGNB n/a
7 TRCN0000017987 GCTATGCCTTGGGATCAAGAT pLKO.1 182 CDS 100% 4.950 3.465 N NANOGNB n/a
8 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 93 CDS 100% 4.950 2.475 Y ERAP2 n/a
9 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 94 CDS 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145465.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.