Transcript: Human NM_001145666.2

Homo sapiens golgi glycoprotein 1 (GLG1), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
GLG1 (2734)
Length:
8215
CDS:
21..3599

Additional Resources:

NCBI RefSeq record:
NM_001145666.2
NBCI Gene record:
GLG1 (2734)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000426946 GAGGTTTGCAAATCTACTATA pLKO_005 519 CDS 100% 13.200 18.480 N GLG1 n/a
2 TRCN0000148641 CCGTTTAATCTGTGGCTTCAT pLKO.1 680 CDS 100% 4.950 3.960 N GLG1 n/a
3 TRCN0000126381 CGAGGCAACATCACTGAGTAT pLKO.1 609 CDS 100% 4.950 3.960 N Glg1 n/a
4 TRCN0000416594 GTGGAAAGTTATCACATTAAA pLKO_005 3664 3UTR 100% 15.000 10.500 N GLG1 n/a
5 TRCN0000434756 TACAGTAGGAGAGACATTTAT pLKO_005 3966 3UTR 100% 15.000 10.500 N GLG1 n/a
6 TRCN0000424164 CCAAGATGACGGCCATCATTT pLKO_005 649 CDS 100% 13.200 9.240 N GLG1 n/a
7 TRCN0000443946 CCGCTTGGAGCCAGATCTATA pLKO_005 2435 CDS 100% 13.200 9.240 N GLG1 n/a
8 TRCN0000421190 TGATCTTGCCATGCAAGTAAT pLKO_005 3383 CDS 100% 13.200 9.240 N GLG1 n/a
9 TRCN0000149520 GAAGACCAGATCCGAATCATT pLKO.1 2940 CDS 100% 5.625 3.938 N GLG1 n/a
10 TRCN0000149748 GCAACCTCACTGAGTTAGAAT pLKO.1 2014 CDS 100% 5.625 3.938 N GLG1 n/a
11 TRCN0000126383 CCAGGATTATAAAGTCAGTTA pLKO.1 1076 CDS 100% 4.950 3.465 N Glg1 n/a
12 TRCN0000146661 CCCAAGATTCAAGTTTCTGAA pLKO.1 834 CDS 100% 4.950 3.465 N GLG1 n/a
13 TRCN0000148720 CCTGTAAAGCTGACATTCCTA pLKO.1 2809 CDS 100% 3.000 2.100 N GLG1 n/a
14 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 5044 3UTR 100% 5.625 2.813 Y KLHL30 n/a
15 TRCN0000148469 CTGGGTTCAAGCAATTCTCTT pLKO.1 4881 3UTR 100% 4.950 2.475 Y C16orf89 n/a
16 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 5044 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145666.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.