Transcript: Mouse NM_001145813.1

Mus musculus E74-like factor 5 (Elf5), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-11
Taxon:
Mus musculus (mouse)
Gene:
Elf5 (13711)
Length:
2125
CDS:
35..796

Additional Resources:

NCBI RefSeq record:
NM_001145813.1
NBCI Gene record:
Elf5 (13711)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001145813.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000081941 CGGAGGTTAGTGTACAAATTT pLKO.1 737 CDS 100% 15.000 21.000 N Elf5 n/a
2 TRCN0000013874 GCCCTGAGATACTACTATAAA pLKO.1 692 CDS 100% 15.000 21.000 N ELF5 n/a
3 TRCN0000081940 ACCGATCTGTTCAGCAATGAA pLKO.1 104 CDS 100% 5.625 7.875 N Elf5 n/a
4 TRCN0000081938 GCCACTAAACTGGGACCTAAT pLKO.1 1334 3UTR 100% 10.800 8.640 N Elf5 n/a
5 TRCN0000428733 ATCAGATCAAACTAGACATTT pLKO_005 846 3UTR 100% 13.200 9.240 N Elf5 n/a
6 TRCN0000426576 GACATCAGTGCACCCTGAATA pLKO_005 172 CDS 100% 13.200 9.240 N Elf5 n/a
7 TRCN0000436259 TGTGACACTGTCTCCTTAATG pLKO_005 1079 3UTR 100% 13.200 9.240 N Elf5 n/a
8 TRCN0000419800 TGACGCAGGAGGAGTTCATTG pLKO_005 309 CDS 100% 10.800 7.560 N Elf5 n/a
9 TRCN0000081942 GACCGGAGGTTAGTGTACAAA pLKO.1 734 CDS 100% 5.625 3.938 N Elf5 n/a
10 TRCN0000081939 GAAGACTACTACCCTGCCTTT pLKO.1 122 CDS 100% 4.050 2.835 N Elf5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145813.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00497 pDONR223 100% 88.1% 94.5% None (many diffs) n/a
2 ccsbBroad304_00497 pLX_304 0% 88.1% 94.5% V5 (many diffs) n/a
3 TRCN0000470383 GCAAAGGTCACAGATGCCTCTAAT pLX_317 59.7% 88.1% 94.5% V5 (many diffs) n/a
Download CSV