Transcript: Human NM_001145816.2

Homo sapiens 15-hydroxyprostaglandin dehydrogenase (HPGD), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-22
Taxon:
Homo sapiens (human)
Gene:
HPGD (3248)
Length:
2880
CDS:
448..984

Additional Resources:

NCBI RefSeq record:
NM_001145816.2
NBCI Gene record:
HPGD (3248)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001145816.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000000197 GAAGGCGGCATCATTATCAAT pLKO.1 832 CDS 100% 5.625 4.500 N HPGD n/a
2 TRCN0000000195 GCTGGAGTGAATAATGAGAAA pLKO.1 721 CDS 100% 4.950 3.960 N HPGD n/a
3 TRCN0000436253 TGCTTTAAATGGTGCTATTAT pLKO_005 991 3UTR 100% 15.000 10.500 N HPGD n/a
4 TRCN0000427212 GACCAAAGGCTAGGTTGTAAT pLKO_005 1279 3UTR 100% 13.200 9.240 N HPGD n/a
5 TRCN0000418011 GACTATGATACAACTCCATTT pLKO_005 1046 3UTR 100% 10.800 7.560 N HPGD n/a
6 TRCN0000000194 ACTCATAACAACACAGACATA pLKO.1 2059 3UTR 100% 4.950 3.465 N HPGD n/a
7 TRCN0000000196 GCAACAACTGAGAGACACTTT pLKO.1 651 CDS 100% 4.950 3.465 N HPGD n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145816.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00782 pDONR223 100% 66.9% 63.5% None 498_499ins164;534_535ins100 n/a
2 ccsbBroad304_00782 pLX_304 0% 66.9% 63.5% V5 498_499ins164;534_535ins100 n/a
3 TRCN0000468979 TTAATATCGTTATTTACTAACGCA pLX_317 52.6% 66.9% 63.5% V5 498_499ins164;534_535ins100 n/a
Download CSV