Construct: ORF TRCN0000468979
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009633.1_s317c1
- Derived from:
- ccsbBroadEn_00782
- DNA Barcode:
- TTAATATCGTTATTTACTAACGCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- HPGD (3248)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000468979
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3248 | HPGD | 15-hydroxyprostaglandin deh... | NM_000860.6 | 100% | 100% | |
| 2 | human | 3248 | HPGD | 15-hydroxyprostaglandin deh... | NM_001256306.1 | 74.4% | 74.4% | 215_216ins204 |
| 3 | human | 3248 | HPGD | 15-hydroxyprostaglandin deh... | NM_001145816.2 | 66.9% | 63.5% | 498_499ins164;534_535ins100 |
| 4 | human | 3248 | HPGD | 15-hydroxyprostaglandin deh... | NM_001363574.2 | 59.5% | 54% | (many diffs) |
| 5 | human | 3248 | HPGD | 15-hydroxyprostaglandin deh... | NM_001256301.1 | 54.5% | 54.5% | 0_1ins363 |
| 6 | human | 3248 | HPGD | 15-hydroxyprostaglandin deh... | NM_001256307.1 | 54.5% | 54.5% | 0_1ins363 |
| 7 | human | 3248 | HPGD | 15-hydroxyprostaglandin deh... | NM_001256305.1 | 53.2% | 52.6% | 422_424delCCCinsG;426_427insT;429_430ins370 |
| 8 | mouse | 15446 | Hpgd | hydroxyprostaglandin dehydr... | NM_008278.2 | 86.8% | 88.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 864
- ORF length:
- 798
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgca cgtgaacggc aaagtggcgc tggtgaccgg cgcggctcag ggcataggca 121 gagcctttgc agaggcgctg ctgcttaagg gcgccaaggt agcgctggtg gattggaatc 181 ttgaagcagg tgtacagtgt aaagctgccc tggatgagca gtttgaacct cagaagactc 241 tgttcatcca gtgcgatgtg gctgaccagc aacaactgag agacactttt agaaaagttg 301 tagaccactt tggaagactg gacattttgg tcaataatgc tggagtgaat aatgagaaaa 361 actgggaaaa aactctgcaa attaatttgg tttctgttat cagtggaacc tatcttggtt 421 tggattacat gagtaagcaa aatGGAGGTG AAGGCGGCAT CATTATCAAT ATGTCATCTT 481 TAGCAGGACT CATGCCCGTT GCACAGCAGC CGGTTTATTG TGCTTCAAAG CATGGCATAG 541 TTGGATTCAC ACGCTCAGCA GCGTTGGCTG CTAATCTTAT GAACAGTGGT GTGAGACTGA 601 ATGCCATTTG TCCAGGCTTT GTTAACACAG CCATCCTTGA ATCAATTGAA AAAGAAGAAA 661 ACATGGGACA ATATATAGAA TATAAGGATC ATATCAAGGA TATGATTAAA TACTATGGAA 721 TTTTGGACCC ACCATTGATT GCCAATGGAT TGATAACACT CATTGAAGAT GATGCTTTAA 781 ATGGTGCTAT TATGAAGATC ACAACTTCTA AGGGAATTCA TTTTCAAGAC TATGATACAA 841 CTCCATTTCA AGCAAAAACC CAATGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 901 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 961 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAT TAATATCGTT 1021 ATTTACTAAC GCAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1081 att