Transcript: Mouse NM_001145834.1

Mus musculus ral guanine nucleotide dissociation stimulator (Ralgds), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Ralgds (19730)
Length:
3741
CDS:
377..2899

Additional Resources:

NCBI RefSeq record:
NM_001145834.1
NBCI Gene record:
Ralgds (19730)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001145834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055074 CGCCAATGTGTTCTATGCCAT pLKO.1 2743 CDS 100% 2.640 2.112 N Ralgds n/a
2 TRCN0000331481 CGCCAATGTGTTCTATGCCAT pLKO_005 2743 CDS 100% 2.640 2.112 N Ralgds n/a
3 TRCN0000055075 GATGCAGAACTATTCAAGAAA pLKO.1 1346 CDS 100% 5.625 3.938 N Ralgds n/a
4 TRCN0000301175 GATGCAGAACTATTCAAGAAA pLKO_005 1346 CDS 100% 5.625 3.938 N Ralgds n/a
5 TRCN0000055076 CGGAAGAACACTTTGGAACAT pLKO.1 2010 CDS 100% 4.950 3.465 N Ralgds n/a
6 TRCN0000301174 CGGAAGAACACTTTGGAACAT pLKO_005 2010 CDS 100% 4.950 3.465 N Ralgds n/a
7 TRCN0000055077 GCACCTACAGAGCCTTCACTA pLKO.1 645 CDS 100% 4.950 3.465 N Ralgds n/a
8 TRCN0000301255 GCACCTACAGAGCCTTCACTA pLKO_005 645 CDS 100% 4.950 3.465 N Ralgds n/a
9 TRCN0000055073 GCCTGCAACAACTACAGCATT pLKO.1 1985 CDS 100% 4.950 3.465 N Ralgds n/a
10 TRCN0000331713 GCCTGCAACAACTACAGCATT pLKO_005 1985 CDS 100% 4.950 3.465 N Ralgds n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145834.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.