Transcript: Mouse NM_001145930.1

Mus musculus YEATS domain containing 2 (Yeats2), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Yeats2 (208146)
Length:
6143
CDS:
193..4416

Additional Resources:

NCBI RefSeq record:
NM_001145930.1
NBCI Gene record:
Yeats2 (208146)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001145930.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000219117 ACAAGCGGATAGATATCATAC pLKO_005 1088 CDS 100% 10.800 15.120 N Yeats2 n/a
2 TRCN0000417949 TCATTGACCAGCGACTGATTG pLKO_005 380 CDS 100% 10.800 15.120 N YEATS2 n/a
3 TRCN0000234216 AGCTAAGCAACTACGTCATTA pLKO_005 3554 CDS 100% 13.200 10.560 N Yeats2 n/a
4 TRCN0000234215 GCAACTACCAGCCACTAATTT pLKO_005 2406 CDS 100% 15.000 10.500 N Yeats2 n/a
5 TRCN0000234217 CCCAGTCCTCCTGACTATTAT pLKO_005 5375 3UTR 100% 15.000 9.000 N Yeats2 n/a
6 TRCN0000219064 TTCCTTCATCCTAGCTATAAA pLKO_005 964 CDS 100% 15.000 9.000 N Yeats2 n/a
7 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 5760 3UTR 100% 4.950 2.475 Y Gad2 n/a
8 TRCN0000432505 AGTACAGGAAGTCCTACAAAC pLKO_005 1732 CDS 100% 10.800 7.560 N YEATS2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001145930.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08565 pDONR223 100% 84.2% 86.3% None (many diffs) n/a
2 ccsbBroad304_08565 pLX_304 0% 84.2% 86.3% V5 (many diffs) n/a
Download CSV