Transcript: Human NM_001146029.3

Homo sapiens semaphorin 7A (John Milton Hagen blood group) (SEMA7A), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-28
Taxon:
Homo sapiens (human)
Gene:
SEMA7A (8482)
Length:
3334
CDS:
41..1999

Additional Resources:

NCBI RefSeq record:
NM_001146029.3
NBCI Gene record:
SEMA7A (8482)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146029.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431655 TGTATTCCCTCGGTGACATTG pLKO_005 1005 CDS 100% 10.800 15.120 N SEMA7A n/a
2 TRCN0000058125 GACGCCATTGTTCCACTCTAA pLKO.1 1192 CDS 100% 4.950 6.930 N SEMA7A n/a
3 TRCN0000058124 CCAGGCTTACGATGACAAGAT pLKO.1 697 CDS 100% 4.950 3.465 N SEMA7A n/a
4 TRCN0000067538 GCATGTTTATTGAAGGATGTT pLKO.1 2545 3UTR 100% 4.950 3.465 N Sema7a n/a
5 TRCN0000058123 CGCCTTCAACATCATGGAGAT pLKO.1 1345 CDS 100% 4.050 2.835 N SEMA7A n/a
6 TRCN0000058126 GCCGTCTGGAAAGGCCATGTA pLKO.1 206 CDS 100% 1.650 1.155 N SEMA7A n/a
7 TRCN0000058127 GCCCACACTCACTCTTGGCTT pLKO.1 1966 CDS 100% 0.880 0.616 N SEMA7A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146029.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01937 pDONR223 100% 97.8% 97.8% None 329_330ins42 n/a
2 ccsbBroad304_01937 pLX_304 0% 97.8% 97.8% V5 329_330ins42 n/a
3 TRCN0000476524 GAATCGGAGGCCGCTCTTATATCA pLX_317 15.7% 97.8% 97.8% V5 329_330ins42 n/a
Download CSV