Transcript: Human NM_001146095.1

Homo sapiens FANCD2 and FANCI associated nuclease 1 (FAN1), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
FAN1 (22909)
Length:
2748
CDS:
189..1790

Additional Resources:

NCBI RefSeq record:
NM_001146095.1
NBCI Gene record:
FAN1 (22909)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146095.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412880 GCTACTGGTCAGAAGTTATAT pLKO_005 1422 CDS 100% 15.000 21.000 N FAN1 n/a
2 TRCN0000242206 AGGCTCTTTCAACGTAAATTA pLKO_005 1446 CDS 100% 15.000 10.500 N Fan1 n/a
3 TRCN0000435987 ATCGTAGTGTGAAAGTCATTT pLKO_005 619 CDS 100% 13.200 9.240 N FAN1 n/a
4 TRCN0000434112 TGTTAAGAGCCTGATTGATAA pLKO_005 752 CDS 100% 13.200 9.240 N FAN1 n/a
5 TRCN0000133972 CCAGATTTCACTCTTAGGAAT pLKO.1 987 CDS 100% 4.950 3.465 N FAN1 n/a
6 TRCN0000138083 GCTCTTTGATGAGCAGGAGAA pLKO.1 1370 CDS 100% 4.050 2.835 N FAN1 n/a
7 TRCN0000133973 CCTTAGAAGATGTAACACCTA pLKO.1 466 CDS 100% 2.640 1.848 N FAN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146095.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11647 pDONR223 100% 99.5% 99.4% None 1_3delATG;27_28insAAA;698G>A n/a
2 ccsbBroad304_11647 pLX_304 0% 99.5% 99.4% V5 1_3delATG;27_28insAAA;698G>A n/a
3 TRCN0000466704 ACGTAGAACTATTACGTTTATCAG pLX_317 23.4% 99.5% 99.4% V5 1_3delATG;27_28insAAA;698G>A n/a
Download CSV