Transcript: Human NM_001146206.1

Homo sapiens RAS guanyl releasing protein 4 (RASGRP4), transcript variant f, mRNA.

Source:
NCBI, updated 2018-06-24
Taxon:
Homo sapiens (human)
Gene:
RASGRP4 (115727)
Length:
2668
CDS:
215..1669

Additional Resources:

NCBI RefSeq record:
NM_001146206.1
NBCI Gene record:
RASGRP4 (115727)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000428852 ACACGGAAGACGAGATCTATG pLKO_005 897 CDS 100% 10.800 15.120 N RASGRP4 n/a
2 TRCN0000412743 ATGCATCCAGTCCTTCGATTC pLKO_005 406 CDS 100% 6.000 8.400 N RASGRP4 n/a
3 TRCN0000417626 AGTCTGTGTTCAAGAATTATG pLKO_005 1062 CDS 100% 13.200 9.240 N RASGRP4 n/a
4 TRCN0000072925 AGAAGAAGTCATAGGTCGTTT pLKO.1 640 CDS 100% 4.950 3.465 N RASGRP4 n/a
5 TRCN0000072926 CCTGCTGACCTCATACCAGAA pLKO.1 517 CDS 100% 4.050 2.835 N RASGRP4 n/a
6 TRCN0000072924 CCACCAGGAATGCACCGGAAA pLKO.1 244 CDS 100% 1.350 0.945 N RASGRP4 n/a
7 TRCN0000072927 CCCTCGGGAAATCAGCAAGGT pLKO.1 319 CDS 100% 0.880 0.616 N RASGRP4 n/a
8 TRCN0000172742 GAGACAGAGTCTTGCTCTGTT pLKO.1 1972 3UTR 100% 0.495 0.248 Y C11orf44 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09420 pDONR223 100% 69.7% 69.6% None 53T>C;510_551del;658_659ins567 n/a
2 ccsbBroad304_09420 pLX_304 0% 69.7% 69.6% V5 53T>C;510_551del;658_659ins567 n/a
3 TRCN0000477794 ACATGTCCTCTTGATTGTTAGTGA pLX_317 16.7% 69.7% 69.6% V5 53T>C;510_551del;658_659ins567 n/a
Download CSV