Transcript: Human NM_001146726.2

Homo sapiens T cell immunoglobulin and mucin domain containing 4 (TIMD4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
TIMD4 (91937)
Length:
1246
CDS:
29..1081

Additional Resources:

NCBI RefSeq record:
NM_001146726.2
NBCI Gene record:
TIMD4 (91937)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001146726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000154537 GCATCTGATACAGCAGTTCCT pLKO.1 788 CDS 100% 2.640 3.696 N TIMD4 n/a
2 TRCN0000151706 CCCATGTCAATGAAGAATGAA pLKO.1 851 CDS 100% 5.625 3.938 N TIMD4 n/a
3 TRCN0000153327 GATGTCTCCTTGACCATCTTA pLKO.1 308 CDS 100% 5.625 3.938 N TIMD4 n/a
4 TRCN0000155792 CCACCCGACAAATGACAACAA pLKO.1 495 CDS 100% 4.950 3.465 N TIMD4 n/a
5 TRCN0000152637 GAAACACACAAGGCTAGACTA pLKO.1 985 CDS 100% 4.950 3.465 N TIMD4 n/a
6 TRCN0000151257 GAAACCTATTGTTCGCAGAAA pLKO.1 968 CDS 100% 4.950 3.465 N TIMD4 n/a
7 TRCN0000155535 GATGACAACCATTGCCGTCTT pLKO.1 580 CDS 100% 4.050 2.835 N TIMD4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001146726.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09327 pDONR223 100% 92.5% 92.3% None 719T>C;758_759ins84 n/a
2 ccsbBroad304_09327 pLX_304 0% 92.5% 92.3% V5 719T>C;758_759ins84 n/a
3 TRCN0000470639 TTCGAACATTTGCTGCTGACCCGC pLX_317 42.8% 92.5% 92.3% V5 719T>C;758_759ins84 n/a
Download CSV