Transcript: Mouse NM_001159389.1

Mus musculus regulatory factor X, 6 (Rfx6), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Rfx6 (320995)
Length:
3457
CDS:
51..2834

Additional Resources:

NCBI RefSeq record:
NM_001159389.1
NBCI Gene record:
Rfx6 (320995)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431448 CTTTCTGGCCAACCGAAATAA pLKO_005 1766 CDS 100% 15.000 21.000 N Rfx6 n/a
2 TRCN0000085961 CCCAGTGTATGTATGGAACTT pLKO.1 2695 CDS 100% 4.950 6.930 N Rfx6 n/a
3 TRCN0000085962 CGTGATGCATAATCTTACCTT pLKO.1 1562 CDS 100% 3.000 4.200 N Rfx6 n/a
4 TRCN0000417247 TGTGCTGGGTCTCCATATAAT pLKO_005 2277 CDS 100% 15.000 12.000 N Rfx6 n/a
5 TRCN0000422061 CACCCATCAACACCGTGTTTA pLKO_005 2788 CDS 100% 13.200 10.560 N Rfx6 n/a
6 TRCN0000085960 GCATAATCTTACCTTGAACAA pLKO.1 1568 CDS 100% 4.950 3.960 N Rfx6 n/a
7 TRCN0000085959 CCTGAAAGTTTGTTAGCAGAT pLKO.1 1062 CDS 100% 4.050 2.835 N Rfx6 n/a
8 TRCN0000085958 CCTCCCTCTTTGGTTTCTAAA pLKO.1 3144 3UTR 100% 13.200 7.920 N Rfx6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159389.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09881 pDONR223 100% 85.9% 87.1% None (many diffs) n/a
2 ccsbBroad304_09881 pLX_304 0% 85.9% 87.1% V5 (many diffs) n/a
3 TRCN0000468782 CCTCTGGACCCAAGGTCATGTAGC pLX_317 .7% 85.9% 87.1% V5 (many diffs) n/a
Download CSV