Transcript: Mouse NM_001159422.1

Mus musculus coiled-coil domain containing 58 (Ccdc58), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ccdc58 (381045)
Length:
747
CDS:
109..513

Additional Resources:

NCBI RefSeq record:
NM_001159422.1
NBCI Gene record:
Ccdc58 (381045)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159422.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000412369 ATGAATTAAACACTACGGTTC pLKO_005 173 CDS 100% 2.250 3.150 N CCDC58 n/a
2 TRCN0000248643 CAGTAGGGACAGAGTTATAAA pLKO_005 273 CDS 100% 15.000 12.000 N Ccdc58 n/a
3 TRCN0000248642 ATGTCGAAGAAGTGGTAAATG pLKO_005 428 CDS 100% 13.200 10.560 N Ccdc58 n/a
4 TRCN0000248644 CCAGACCTCAGCAGTAGTAAA pLKO_005 306 CDS 100% 13.200 10.560 N Ccdc58 n/a
5 TRCN0000257573 CATCGCCTGGGCATGACAGAT pLKO_005 544 3UTR 100% 1.650 1.320 N Ccdc58 n/a
6 TRCN0000248645 CTGGATGACTTAACGTTATTA pLKO_005 355 CDS 100% 15.000 10.500 N Ccdc58 n/a
7 TRCN0000192129 CCTGGATGACTTAACGTTATT pLKO.1 354 CDS 100% 13.200 9.240 N Ccdc58 n/a
8 TRCN0000201071 CAAACCTGTAAACAGCTGTAT pLKO.1 229 CDS 100% 4.950 3.465 N Ccdc58 n/a
9 TRCN0000129358 GAGTCTTTGATGGCAGCTCAT pLKO.1 250 CDS 100% 4.050 2.835 N CCDC58 n/a
10 TRCN0000419607 GATGAGGACAATTGATGACAG pLKO_005 144 CDS 100% 4.050 2.835 N CCDC58 n/a
11 TRCN0000128644 CAAAGTTGAAATGGATGCAGT pLKO.1 398 CDS 100% 2.640 1.848 N CCDC58 n/a
12 TRCN0000189838 GAGTTCACTTCAAGCCTCCAA pLKO.1 482 CDS 100% 2.640 1.848 N Ccdc58 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159422.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04870 pDONR223 100% 86.6% 85.4% None (many diffs) n/a
2 ccsbBroad304_04870 pLX_304 0% 86.6% 85.4% V5 (many diffs) n/a
3 TRCN0000491783 CAACCGTCTACAATTCTAAAACAT pLX_317 58% 86.6% 85.4% V5 (many diffs) n/a
Download CSV