Transcript: Mouse NM_001159543.1

Mus musculus dipeptidylpeptidase 4 (Dpp4), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-03
Taxon:
Mus musculus (mouse)
Gene:
Dpp4 (13482)
Length:
3654
CDS:
441..2630

Additional Resources:

NCBI RefSeq record:
NM_001159543.1
NBCI Gene record:
Dpp4 (13482)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031290 CGTATTCACTAGCTGACTATT pLKO.1 559 CDS 100% 13.200 18.480 N Dpp4 n/a
2 TRCN0000452871 ATAAGATCATCAGCGACAAAG pLKO_005 1537 CDS 100% 10.800 15.120 N Dpp4 n/a
3 TRCN0000442417 CAGTATTATGCGGTATCATTT pLKO_005 1785 CDS 100% 13.200 9.240 N Dpp4 n/a
4 TRCN0000031291 CCAAGAAATATCCTCTACTAT pLKO.1 2032 CDS 100% 5.625 3.938 N Dpp4 n/a
5 TRCN0000031293 GCATGCAATCAACAGAAGATT pLKO.1 2195 CDS 100% 5.625 3.938 N Dpp4 n/a
6 TRCN0000031289 GCTCATTGAATACTCCTTCTA pLKO.1 1124 CDS 100% 4.950 3.465 N Dpp4 n/a
7 TRCN0000050774 CCAGAAGACAACCTTGACCAT pLKO.1 2448 CDS 100% 2.640 1.584 N DPP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159543.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06116 pDONR223 100% 82.2% 80.6% None (many diffs) n/a
2 ccsbBroad304_06116 pLX_304 0% 82.2% 80.6% V5 (many diffs) n/a
3 TRCN0000477379 AAACCAAAAGACTGACGCAGTGGA pLX_317 16.9% 82.2% 80.6% V5 (many diffs) n/a
Download CSV