Transcript: Mouse NM_001159618.1

Mus musculus phosphatidylinositol glycan anchor biosynthesis, class P (Pigp), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Pigp (56176)
Length:
852
CDS:
121..606

Additional Resources:

NCBI RefSeq record:
NM_001159618.1
NBCI Gene record:
Pigp (56176)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000276477 TTGCCAGAAAGAGCGATTTAT pLKO_005 232 CDS 100% 15.000 21.000 N PIGP n/a
2 TRCN0000124348 CATTCATACGATCACAGATAA pLKO.1 465 CDS 100% 13.200 18.480 N Pigp n/a
3 TRCN0000326212 CATTCATACGATCACAGATAA pLKO_005 465 CDS 100% 13.200 18.480 N Pigp n/a
4 TRCN0000124345 CCTCCTTATCACAGTTGTAAT pLKO.1 390 CDS 100% 13.200 18.480 N Pigp n/a
5 TRCN0000326211 CCTCCTTATCACAGTTGTAAT pLKO_005 390 CDS 100% 13.200 18.480 N Pigp n/a
6 TRCN0000124347 CGTTCCCGAATCTTGGTTAAA pLKO.1 312 CDS 100% 13.200 18.480 N Pigp n/a
7 TRCN0000326214 CGTTCCCGAATCTTGGTTAAA pLKO_005 312 CDS 100% 13.200 18.480 N Pigp n/a
8 TRCN0000124344 GCTGTGTATAAACATCCTAAA pLKO.1 613 3UTR 100% 10.800 8.640 N Pigp n/a
9 TRCN0000326139 GCTGTGTATAAACATCCTAAA pLKO_005 613 3UTR 100% 10.800 8.640 N Pigp n/a
10 TRCN0000124346 CCCATTAGTGAAGTAAACAAA pLKO.1 550 CDS 100% 5.625 3.938 N Pigp n/a
11 TRCN0000326138 CCCATTAGTGAAGTAAACAAA pLKO_005 550 CDS 100% 5.625 3.938 N Pigp n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159618.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03248 pDONR223 100% 70.3% 74.2% None (many diffs) n/a
2 ccsbBroad304_03248 pLX_304 0% 70.3% 74.2% V5 (many diffs) n/a
3 TRCN0000466756 CAAATACATCGGTACACGCTCTTG pLX_317 96.4% 70.3% 74.2% V5 (many diffs) n/a
Download CSV