Transcript: Human NM_001159629.1

Homo sapiens solute carrier family 27 member 2 (SLC27A2), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-09-29
Taxon:
Homo sapiens (human)
Gene:
SLC27A2 (11001)
Length:
2249
CDS:
233..1936

Additional Resources:

NCBI RefSeq record:
NM_001159629.1
NBCI Gene record:
SLC27A2 (11001)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043389 GCTGATTACCTACCTAGTTAT pLKO.1 1712 CDS 100% 13.200 18.480 N SLC27A2 n/a
2 TRCN0000300379 GCTGATTACCTACCTAGTTAT pLKO_005 1712 CDS 100% 13.200 18.480 N SLC27A2 n/a
3 TRCN0000043391 CCTATGACTGAGGACATCTAT pLKO.1 1883 CDS 100% 5.625 3.938 N SLC27A2 n/a
4 TRCN0000300460 CCTATGACTGAGGACATCTAT pLKO_005 1883 CDS 100% 5.625 3.938 N SLC27A2 n/a
5 TRCN0000043392 CCATACTTCTTCCAGGACATA pLKO.1 302 CDS 100% 4.950 3.465 N SLC27A2 n/a
6 TRCN0000300461 CCATACTTCTTCCAGGACATA pLKO_005 302 CDS 100% 4.950 3.465 N SLC27A2 n/a
7 TRCN0000043388 CCATCTATTATGTGAGCAGAA pLKO.1 765 CDS 100% 4.050 2.835 N SLC27A2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159629.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02591 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_02591 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000479907 GTTTATCTCTATGGTCGCGAAACC pLX_317 23.5% 100% 100% V5 n/a
Download CSV