Transcript: Mouse NM_001159641.2

Mus musculus taspase, threonine aspartase 1 (Tasp1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Tasp1 (75812)
Length:
2148
CDS:
121..1272

Additional Resources:

NCBI RefSeq record:
NM_001159641.2
NBCI Gene record:
Tasp1 (75812)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032339 CGACAATCAAGCGCAAAGGAA pLKO.1 778 CDS 100% 3.000 4.200 N Tasp1 n/a
2 TRCN0000005964 CGAGCTTGTCAGAAGGCAATT pLKO.1 319 CDS 100% 10.800 8.640 N TASP1 n/a
3 TRCN0000032341 GTAACAGTCAAGGAGTTAGAA pLKO.1 193 CDS 100% 5.625 3.938 N Tasp1 n/a
4 TRCN0000032340 CAAGATAAACAGACACTGCTT pLKO.1 1084 CDS 100% 2.640 1.848 N Tasp1 n/a
5 TRCN0000032343 CTAAATCTCTTAGGAGAGATT pLKO.1 439 CDS 100% 0.495 0.347 N Tasp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159641.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487713 TCCGCTATTGTCCTTTTATGTTTA pLX_317 18.6% 83.4% 85.7% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489233 CCTGGCGAGCATCCCAATCAAGTT pLX_317 28.7% 83.3% 85.5% V5 (many diffs) n/a
Download CSV