Construct: ORF TRCN0000489233
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF019367.1_s317c1
- DNA Barcode:
- CCTGGCGAGCATCCCAATCAAGTT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TASP1 (55617)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000489233
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 55617 | TASP1 | taspase 1 | NM_017714.3 | 99.9% | 99.7% | 1260_1261insG |
| 2 | human | 55617 | TASP1 | taspase 1 | NM_001323603.1 | 75.6% | 75.5% | 0_1ins306;954_955insG |
| 3 | human | 55617 | TASP1 | taspase 1 | NM_001323604.1 | 75.6% | 75.5% | 0_1ins306;954_955insG |
| 4 | human | 55617 | TASP1 | taspase 1 | XM_011529292.1 | 75.6% | 75.5% | 0_1ins306;954_955insG |
| 5 | human | 55617 | TASP1 | taspase 1 | XM_011529294.1 | 75.6% | 75.5% | 0_1ins306;954_955insG |
| 6 | human | 55617 | TASP1 | taspase 1 | XM_017027927.1 | 75.6% | 75.5% | 0_1ins306;954_955insG |
| 7 | human | 55617 | TASP1 | taspase 1 | XM_017027928.1 | 75.6% | 75.5% | 0_1ins306;954_955insG |
| 8 | human | 55617 | TASP1 | taspase 1 | NM_001323602.1 | 68.7% | 68.6% | 280_281ins393;867_868insG |
| 9 | human | 55617 | TASP1 | taspase 1 | XR_001754319.2 | 66.1% | (many diffs) | |
| 10 | human | 55617 | TASP1 | taspase 1 | XM_017027929.2 | 58.9% | 54.8% | (many diffs) |
| 11 | human | 55617 | TASP1 | taspase 1 | XM_017027930.1 | 55.6% | 55.5% | 0_1ins558;702_703insG |
| 12 | human | 55617 | TASP1 | taspase 1 | XM_017027931.2 | 53.5% | 53.4% | 675_676ins586 |
| 13 | human | 55617 | TASP1 | taspase 1 | XR_001754320.2 | 53.2% | 1_111del;1097_1119del;1395_2368delinsG | |
| 14 | human | 55617 | TASP1 | taspase 1 | XR_430268.2 | 53.1% | 1_111del;972_973insGTGAGTACCTCAG;1359_2332delinsG | |
| 15 | human | 55617 | TASP1 | taspase 1 | XR_001754321.2 | 52.6% | (many diffs) | |
| 16 | human | 55617 | TASP1 | taspase 1 | NR_136628.1 | 48.1% | (many diffs) | |
| 17 | human | 55617 | TASP1 | taspase 1 | XR_001754323.1 | 47.9% | (many diffs) | |
| 18 | human | 55617 | TASP1 | taspase 1 | XR_001754325.1 | 47.5% | (many diffs) | |
| 19 | human | 55617 | TASP1 | taspase 1 | NR_136629.1 | 45.3% | 1_117del;604_605ins187;1191_2181delinsG | |
| 20 | human | 55617 | TASP1 | taspase 1 | NR_136631.1 | 43.2% | (many diffs) | |
| 21 | human | 55617 | TASP1 | taspase 1 | NR_136630.1 | 40.2% | (many diffs) | |
| 22 | human | 55617 | TASP1 | taspase 1 | XR_001754324.1 | 39.3% | (many diffs) | |
| 23 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | NM_001159640.2 | 91.8% | 94.2% | (many diffs) |
| 24 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | NM_175225.5 | 91.8% | 94.2% | (many diffs) |
| 25 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | XM_017319311.1 | 87.1% | 89% | (many diffs) |
| 26 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | XM_011239829.2 | 87% | 89.4% | (many diffs) |
| 27 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | XM_017319309.1 | 87% | 89.4% | (many diffs) |
| 28 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | NM_001159641.2 | 83.3% | 85.5% | (many diffs) |
| 29 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | XM_017319310.1 | 79% | 81% | (many diffs) |
| 30 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | XM_017319312.1 | 76.8% | 74.3% | (many diffs) |
| 31 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | XM_017319313.1 | 66.2% | 68.6% | (many diffs) |
| 32 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | XM_017319314.1 | 66.2% | 68.6% | (many diffs) |
| 33 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | XM_017319315.1 | 51.4% | 53.4% | (many diffs) |
| 34 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | NR_110351.1 | 50.6% | (many diffs) | |
| 35 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | NR_110352.1 | 48% | (many diffs) | |
| 36 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | XR_001783198.1 | 46.1% | (many diffs) | |
| 37 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | NR_110350.1 | 42.3% | (many diffs) | |
| 38 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | NM_001289611.1 | 36.5% | 35.4% | (many diffs) |
| 39 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | XR_866346.2 | 36% | (many diffs) | |
| 40 | mouse | 75812 | Tasp1 | taspase, threonine aspartase 1 | XR_866347.2 | 32.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 59
- ORF end:
- 1322
- ORF length:
- 1263
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaccat 61 gaccatggag aaggggatga gttctggaga agggctgcct tccagatcat ctcaggtttc 121 ggctggtaaa ataacagcca aagagttgga aacaaagcag tcctataaag agaaacgagg 181 aggctttgtg ttggtgcatg caggtgcagg ttatcattct gaatccaaag ccaaggagta 241 taaacatgta tgcaaacgag cttgtcagaa ggcaattgaa aagctgcagg ccggtgctct 301 tgcaactgac gcagtcactg cagcactggt ggaacttgag gattctcctt ttacaaatgc 361 aggaatggga tctaatctaa atctgttagg tgaaattgag tgtgatgcca gcataatgga 421 tggaaaatcc ttaaattttg gagcagttgg agcactgagt ggaatcaaga acccagtctc 481 ggttgccaac agactcttat gtgaagggca gaagggcaag ctctcggctg gcagaattcc 541 tccctgcttt ttagttggag aaggagccta cagatgggca gtagatcatg gaataccctc 601 ttgccctcct aacatcatga ccacaagatt cagtttagct gcatttaaaa gaaacaagag 661 gaaactagag ctggcagaaa gggtggacac agattttatg caactaaaga aaagaagaca 721 atcaagtgag aaggaaaatg actcaggcac tttggacacg gtaggcgctg tggttgtgga 781 ccacgaaggg aatgttgctg ctgctgtctc cagtggaggc ttggccttga aacatccggg 841 gagagttggg caggctgctc tttatggatg tggctgctgg gctgaaaata ctggagctca 901 taacccctac tccacagctg tgagtacctc aggatgtgga gagcatcttg tgcgcaccat 961 actGGCTAGA GAATGTTCAC ATGCTTTACA AGCTGAGGAT GCTCACCAAG CCCTGTTGGA 1021 GACTATGCAA AACAAGTTTA TCAGTTCACC TTTCCTTGCC AGTGAAGATG GCGTGCTTGG 1081 CGGAGTGATT GTCCTCCGTT CATGCAGATG TTCTGCCGAG CCTGACTCCT CCCAAAATAA 1141 GCAGACACTT CTAGTGGAAT TTCTGTGGAG CCACACGACG GAGAGCATGT GTGTCGGATA 1201 TATGTCAGCC CAGGATGGGA AAGCCAAGAC TCACATTTCA AGACTTCCTC CTGGTGCGGT 1261 GGCAGGACAG TCTGTGGCAA TCGAAGGTGG GGTGTGCCGC CTGGAGAGCC CAGTGAACGA 1321 CCCAGCTTTC TTGTACAAAG TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG 1381 TCTCGATTCT ACGTAGTAAT GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT 1441 TTATATATCT TGTGGAAAGG ACGACCTGGC GAGCATCCCA ATCAAGTTAC GCGTTAAGTC 1501 gacaatcaac ctctggatta caaaatttgt gaaagatt