Transcript: Mouse NM_001159745.1

Mus musculus ST8 alpha-N-acetyl-neuraminide alpha-2,8-sialyltransferase 4 (St8sia4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
St8sia4 (20452)
Length:
1394
CDS:
334..1134

Additional Resources:

NCBI RefSeq record:
NM_001159745.1
NBCI Gene record:
St8sia4 (20452)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159745.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000433164 AGCACGTGGAGTGGGTTAATG pLKO_005 1037 CDS 100% 13.200 10.560 N ST8SIA4 n/a
2 TRCN0000093936 GCCTGAAGTTTCACCAATGAA pLKO.1 717 CDS 100% 5.625 3.938 N St8sia4 n/a
3 TRCN0000093937 CCTGAAGTTTCACCAATGAAA pLKO.1 718 CDS 100% 0.563 0.394 N St8sia4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159745.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07186 pDONR223 100% 56.8% 60.5% None (many diffs) n/a
2 ccsbBroad304_07186 pLX_304 0% 56.8% 60.5% V5 (many diffs) n/a
3 TRCN0000470116 TCTGCCCACCCAGCGGGCCTGAGG pLX_317 3.8% 56.8% 60.5% V5 (many diffs) n/a
Download CSV