Transcript: Mouse NM_001159888.1

Mus musculus OCIA domain containing 1 (Ociad1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-21
Taxon:
Mus musculus (mouse)
Gene:
Ociad1 (68095)
Length:
1421
CDS:
189..758

Additional Resources:

NCBI RefSeq record:
NM_001159888.1
NBCI Gene record:
Ociad1 (68095)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001159888.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000175339 CTTCCTCGTTATGAGCCAATT pLKO.1 660 CDS 100% 10.800 15.120 N Ociad1 n/a
2 TRCN0000278773 CTTCCTCGTTATGAGCCAATT pLKO_005 660 CDS 100% 10.800 15.120 N Ociad1 n/a
3 TRCN0000193191 CGATAACTGATAGTGCATGTT pLKO.1 1141 3UTR 100% 4.950 6.930 N Ociad1 n/a
4 TRCN0000278830 CGATAACTGATAGTGCATGTT pLKO_005 1141 3UTR 100% 4.950 6.930 N Ociad1 n/a
5 TRCN0000217212 CACAAGTGTCAAGACCTATTC pLKO.1 223 CDS 100% 10.800 7.560 N Ociad1 n/a
6 TRCN0000194353 CGGTGGGTTTATGCCATAGTT pLKO.1 1035 3UTR 100% 5.625 3.938 N Ociad1 n/a
7 TRCN0000173174 CCCATCATTGGACCTACTGAA pLKO.1 831 3UTR 100% 4.950 3.465 N Ociad1 n/a
8 TRCN0000278775 CCCATCATTGGACCTACTGAA pLKO_005 831 3UTR 100% 4.950 3.465 N Ociad1 n/a
9 TRCN0000193655 CGATGCTTTACAGACTCAGAT pLKO.1 969 3UTR 100% 4.950 3.465 N Ociad1 n/a
10 TRCN0000173547 GCTGCCACAAGTATGCTGATT pLKO.1 339 CDS 100% 4.950 3.465 N Ociad1 n/a
11 TRCN0000278862 GCTGCCACAAGTATGCTGATT pLKO_005 339 CDS 100% 4.950 3.465 N Ociad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159888.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03490 pDONR223 100% 64.6% 63.9% None (many diffs) n/a
2 ccsbBroad304_03490 pLX_304 0% 64.6% 63.9% V5 (many diffs) n/a
3 TRCN0000474961 GGGTACGGAACGTCACGCGGCCGC pLX_317 74.3% 64.6% 63.9% V5 (many diffs) n/a
Download CSV