Transcript: Mouse NM_001160099.1

Mus musculus claudin 10 (Cldn10), transcript variant b_v1, mRNA.

Source:
NCBI, updated 2017-04-15
Taxon:
Mus musculus (mouse)
Gene:
Cldn10 (58187)
Length:
852
CDS:
41..628

Additional Resources:

NCBI RefSeq record:
NM_001160099.1
NBCI Gene record:
Cldn10 (58187)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001160099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000091710 CCAGGCATGTAGAGGACTAAT pLKO.1 268 CDS 100% 13.200 9.240 N Cldn10 n/a
2 TRCN0000091711 GCTCAGATCAAGCCAAAGCTA pLKO.1 363 CDS 100% 3.000 2.100 N Cldn10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001160099.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02073 pDONR223 100% 74.8% 78.1% None (many diffs) n/a
2 ccsbBroad304_02073 pLX_304 0% 74.8% 78.1% V5 (many diffs) n/a
3 TRCN0000465260 CCGTCCAGCCGGTATACATTTAAA pLX_317 48.1% 74.8% 78.1% V5 (many diffs) n/a
Download CSV