Transcript: Human NM_001160183.3

Homo sapiens zinc finger protein 138 (ZNF138), transcript variant 2, mRNA.

Source:
NCBI, updated 2018-12-08
Taxon:
Homo sapiens (human)
Gene:
ZNF138 (7697)
Length:
2716
CDS:
142..522

Additional Resources:

NCBI RefSeq record:
NM_001160183.3
NBCI Gene record:
ZNF138 (7697)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001160183.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000429634 TAACAACTTACTGAACATAAG pLKO_005 1236 3UTR 100% 10.800 7.560 N ZNF138 n/a
2 TRCN0000012919 CTGGTCCACAAACCTTTCTAA pLKO.1 893 3UTR 100% 5.625 3.938 N ZNF138 n/a
3 TRCN0000012922 CACAAACCTTTCTAAACCTAA pLKO.1 899 3UTR 100% 4.950 3.465 N ZNF138 n/a
4 TRCN0000414608 GCGGAATGTATATAGGCATGT pLKO_005 216 CDS 100% 4.050 2.835 N ZNF138 n/a
5 TRCN0000421902 ACAATGTGGCAAGGTCTTTAA pLKO_005 1124 3UTR 100% 13.200 7.920 N ZNF138 n/a
6 TRCN0000434325 ACACTGTGGCAAAGCCTTTAA pLKO_005 1040 3UTR 100% 13.200 7.920 N ZNF138 n/a
7 TRCN0000424428 ACCTTACTAGACATAAGATAA pLKO_005 1072 3UTR 100% 13.200 7.920 N ZNF138 n/a
8 TRCN0000413885 AGCTCACTGAACATAAGTTAA pLKO_005 1408 3UTR 100% 13.200 7.920 N ZNF138 n/a
9 TRCN0000417549 CAATCCTCAATCCTTACTAAA pLKO_005 978 3UTR 100% 13.200 7.920 N ZNF138 n/a
10 TRCN0000012920 CCCTTACTAAACATCAGATAA pLKO.1 1156 3UTR 100% 13.200 7.920 N ZNF138 n/a
11 TRCN0000422662 TTCACGCCTAACTCAACATAA pLKO_005 815 3UTR 100% 13.200 7.920 N ZNF138 n/a
12 TRCN0000420316 AGAATGTGACAAATCACTTTG pLKO_005 788 3UTR 100% 10.800 6.480 N ZNF138 n/a
13 TRCN0000012918 CCTCAACTCTTATTACACATA pLKO.1 1570 3UTR 100% 4.950 2.970 N ZNF138 n/a
14 TRCN0000428574 CTGAAGAGAAACCCTACAAAT pLKO_005 1099 3UTR 100% 13.200 6.600 Y ZNF138 n/a
15 TRCN0000107875 CACTTGATTGTAGGTAAGATA pLKO.1 2484 3UTR 100% 5.625 2.813 Y ZNF254 n/a
16 TRCN0000017702 CCCTGGAATATGAAGAGACAT pLKO.1 304 CDS 100% 4.950 2.475 Y ZNF430 n/a
17 TRCN0000019457 CCTCACACCTTACTAGACATA pLKO.1 1066 3UTR 100% 4.950 2.475 Y ZNF681 n/a
18 TRCN0000018502 GATGTTAGAGAACTACAGAAA pLKO.1 237 CDS 100% 4.950 2.475 Y ZNF493 n/a
19 TRCN0000158848 GAGAAACCTTACAAATGTGAT pLKO.1 1776 3UTR 100% 4.950 2.475 Y ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001160183.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15729 pDONR223 0% 49% 44.8% None (many diffs) n/a
2 ccsbBroad304_15729 pLX_304 0% 49% 44.8% V5 (many diffs) n/a
3 TRCN0000470492 GCCGACTTGCTCCATGATGCAGCT pLX_317 100% 49% 44.8% V5 (many diffs) n/a
4 ccsbBroadEn_13746 pDONR223 100% 45.6% 40.6% None (many diffs) n/a
5 ccsbBroad304_13746 pLX_304 0% 45.6% 40.6% V5 (many diffs) n/a
6 TRCN0000475669 ATTCGCAGCGAGTTTGTCCGCCGC pLX_317 100% 45.6% 40.6% V5 (many diffs) n/a
Download CSV