Transcript: Human NM_001160224.2

Homo sapiens ring finger protein 170 (RNF170), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
RNF170 (81790)
Length:
1886
CDS:
130..732

Additional Resources:

NCBI RefSeq record:
NM_001160224.2
NBCI Gene record:
RNF170 (81790)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001160224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000033976 GCTTTGATTGCTACCCTGGTA pLKO.1 232 CDS 100% 2.640 3.696 N RNF170 n/a
2 TRCN0000231906 TGATTGCTACCCTGGTATATG pLKO_005 236 CDS 100% 13.200 9.240 N RNF170 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001160224.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10260 pDONR223 100% 56.9% 54.2% None (many diffs) n/a
2 ccsbBroad304_10260 pLX_304 0% 56.9% 54.2% V5 (many diffs) n/a
3 TRCN0000480084 CGCACCAGATAGGTTAACGTGATC pLX_317 100% 56.9% 54.2% V5 (many diffs) n/a
Download CSV