Transcript: Mouse NM_001161371.1

Mus musculus SS18, nBAF chromatin remodeling complex subunit (Ss18), transcript variant 4, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ss18 (268996)
Length:
2795
CDS:
180..1121

Additional Resources:

NCBI RefSeq record:
NM_001161371.1
NBCI Gene record:
Ss18 (268996)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001161371.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108560 CCAGGGAATATGACTGAATAT pLKO.1 2408 3UTR 100% 13.200 9.240 N Ss18 n/a
2 TRCN0000119079 GAAGGCATGAACCAGCAATAT pLKO.1 807 CDS 100% 13.200 9.240 N SS18 n/a
3 TRCN0000108563 GCTCGCAGTATCAGCAGATAT pLKO.1 319 CDS 100% 13.200 9.240 N Ss18 n/a
4 TRCN0000316421 GCTCGCAGTATCAGCAGATAT pLKO_005 319 CDS 100% 13.200 9.240 N Ss18 n/a
5 TRCN0000359497 TGGTATACCTTGCTACAATAG pLKO_005 352 CDS 100% 10.800 7.560 N SS18 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001161371.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07004 pDONR223 100% 68.2% 71.5% None (many diffs) n/a
2 ccsbBroad304_07004 pLX_304 0% 68.2% 71.5% V5 (many diffs) n/a
3 TRCN0000467495 TCTGGGGAAACTTTGTTATGCGTC pLX_317 30.5% 68.2% 71.5% V5 (many diffs) n/a
Download CSV