Transcript: Mouse NM_001162974.1

Mus musculus leucine rich repeat containing 51 (Lrrc51), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Lrrc51 (69358)
Length:
939
CDS:
57..497

Additional Resources:

NCBI RefSeq record:
NM_001162974.1
NBCI Gene record:
Lrrc51 (69358)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001162974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347016 AGGTAAGTGCCTGGATCTAAG pLKO_005 492 CDS 100% 10.800 15.120 N Lrrc51 n/a
2 TRCN0000347011 CCATTGACCCTGTCCTAACAA pLKO_005 334 CDS 100% 5.625 7.875 N Lrrc51 n/a
3 TRCN0000347094 AGGACGTACCAGACCTCTAAG pLKO_005 591 3UTR 100% 10.800 7.560 N Lrrc51 n/a
4 TRCN0000347093 ATGTCCTCAATGATCTGAAAG pLKO_005 232 CDS 100% 10.800 7.560 N Lrrc51 n/a
5 TRCN0000346941 ATGGTCCAAGATCTGGTAACC pLKO_005 129 CDS 100% 4.050 2.835 N Lrrc51 n/a
6 TRCN0000131103 GCATGAACATCAAGCCCAAGA pLKO.1 808 3UTR 100% 4.050 2.835 N LRTOMT n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001162974.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05241 pDONR223 100% 66.6% 66.6% None (many diffs) n/a
2 ccsbBroad304_05241 pLX_304 0% 66.6% 66.6% V5 (many diffs) n/a
3 TRCN0000475834 TGGGCCAAAGTAAAATCCATAGAT pLX_317 41% 66.6% 66.6% V5 (many diffs) n/a
Download CSV