Construct: ORF TRCN0000475834
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013615.1_s317c1
- Derived from:
- ccsbBroadEn_05241
- DNA Barcode:
- TGGGCCAAAGTAAAATCCATAGAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- LRTOMT (220074)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000475834
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 220074 | LRTOMT | leucine rich transmembrane ... | NM_001318803.1 | 100% | 100% | |
2 | human | 220074 | LRTOMT | leucine rich transmembrane ... | NM_145309.5 | 100% | 100% | |
3 | human | 220074 | LRTOMT | leucine rich transmembrane ... | XM_006718473.4 | 100% | 100% | |
4 | human | 220074 | LRTOMT | leucine rich transmembrane ... | XM_006718474.4 | 100% | 100% | |
5 | human | 220074 | LRTOMT | leucine rich transmembrane ... | XM_011544847.3 | 100% | 100% | |
6 | human | 220074 | LRTOMT | leucine rich transmembrane ... | XM_011544848.3 | 100% | 100% | |
7 | human | 220074 | LRTOMT | leucine rich transmembrane ... | NM_001205138.3 | 89.7% | 86.9% | (many diffs) |
8 | human | 220074 | LRTOMT | leucine rich transmembrane ... | NM_001145307.4 | 80.1% | 71.5% | (many diffs) |
9 | human | 220074 | LRTOMT | leucine rich transmembrane ... | NM_001271471.2 | 76% | 76% | 438_439ins138 |
10 | human | 220074 | LRTOMT | leucine rich transmembrane ... | NR_134858.1 | 22.4% | (many diffs) | |
11 | human | 220074 | LRTOMT | leucine rich transmembrane ... | NR_026886.3 | 20.2% | 1_694del;777_956del;1451_2838del | |
12 | mouse | 69358 | Lrrc51 | leucine rich repeat contain... | NM_001162973.1 | 87% | 85.9% | (many diffs) |
13 | mouse | 69358 | Lrrc51 | leucine rich repeat contain... | NM_027053.1 | 87% | 85.9% | (many diffs) |
14 | mouse | 69358 | Lrrc51 | leucine rich repeat contain... | XM_006508182.3 | 87% | 85.9% | (many diffs) |
15 | mouse | 69358 | Lrrc51 | leucine rich repeat contain... | XM_006508183.3 | 87% | 85.9% | (many diffs) |
16 | mouse | 69358 | Lrrc51 | leucine rich repeat contain... | XM_011241893.2 | 87% | 85.9% | (many diffs) |
17 | mouse | 69358 | Lrrc51 | leucine rich repeat contain... | XM_011241894.2 | 87% | 85.9% | (many diffs) |
18 | mouse | 69358 | Lrrc51 | leucine rich repeat contain... | XM_011241895.2 | 87% | 85.9% | (many diffs) |
19 | mouse | 69358 | Lrrc51 | leucine rich repeat contain... | XM_011241896.1 | 87% | 85.9% | (many diffs) |
20 | mouse | 69358 | Lrrc51 | leucine rich repeat contain... | NM_001162974.1 | 66.6% | 66.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 645
- ORF length:
- 576
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gaacaaacgg gactatatga acacttcggt acaggagccc cctcttgact 121 actccttcag aagcatccac gtcattcaag atctggtaaa tgaggagcca aggacaggac 181 tacgaccact gaagcgttca aagtcgggga aatcactgac ccagtccctg tggctgaata 241 acaatgttct caatgatctg agagacttca accaggtggc ttcacagctg ttggagcacc 301 cagagaacct ggcctggatc gacctgtcct ttaatgacct gacttccatt gaccctgtcc 361 taacaacttt cttcaacctg agtgtcctct atcttcacgg caacagcatC CAGCGCCTGG 421 GGGAGGTGAA TAAGCTGGCT GTCCTTCCTC GGCTCCGTAG CCTGACACTC CATGGGAACC 481 CCATGGAGGA AGAGAAAGGG TATAGGCAAT ATGTGCTGTG CACCCTGTCC CGTATCACCA 541 CGTTCGACTT CAGTGGGGTC ACCAAAGCAG ACCGCACCAC AGCTGAAGTC TGGAAACGCA 601 TGAACATCAA GCCCAAGAAG GCCTGGACCA AGCAGAATAC ACTTTTGCCA ACTTTCTTGT 661 ACAAAGTGGT TGATATCGGT AAGCCTATCC CTAACCCTCT CCTCGGTCTC GATTCTACGT 721 AGTAATGAAC TAGTCCGTAA CTTGAAAGTA TTTCGATTTT TGGCTTTATA TATCTTGTGG 781 AAAGGACGAT GGGCCAAAGT AAAATCCATA GATACGCGTT AAGTCgacaa tcaacctctg 841 gattacaaaa tttgtgaaag att