Transcript: Mouse NM_001162989.1

Mus musculus phosphorylated adaptor for RNA export (Phax), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Phax (56698)
Length:
1783
CDS:
126..1217

Additional Resources:

NCBI RefSeq record:
NM_001162989.1
NBCI Gene record:
Phax (56698)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001162989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305129 TGCGCACCGGTGTCACATTAT pLKO_005 183 CDS 100% 13.200 18.480 N Phax n/a
2 TRCN0000125910 CCGATGACGATTGCTCTCTTT pLKO.1 247 CDS 100% 4.950 6.930 N Phax n/a
3 TRCN0000315567 CCGATGACGATTGCTCTCTTT pLKO_005 247 CDS 100% 4.950 6.930 N Phax n/a
4 TRCN0000125909 CGGCACGGGTTAAATCTCATT pLKO.1 1403 3UTR 100% 4.950 6.930 N Phax n/a
5 TRCN0000305130 GTGTACTGAGACTAGAGAAAG pLKO_005 1292 3UTR 100% 10.800 8.640 N Phax n/a
6 TRCN0000125912 CCTATAACTATTTGCTTGCTA pLKO.1 481 CDS 100% 3.000 2.400 N Phax n/a
7 TRCN0000125913 GTCTGAGACCTATAACTATTT pLKO.1 473 CDS 100% 13.200 9.240 N Phax n/a
8 TRCN0000308480 GTCTGAGACCTATAACTATTT pLKO_005 473 CDS 100% 13.200 9.240 N Phax n/a
9 TRCN0000125911 GCCATTGAACTTCTGATGGAA pLKO.1 804 CDS 100% 3.000 2.100 N Phax n/a
10 TRCN0000308481 GCCATTGAACTTCTGATGGAA pLKO_005 804 CDS 100% 3.000 2.100 N Phax n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001162989.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14156 pDONR223 100% 76.3% 78.9% None (many diffs) n/a
2 ccsbBroad304_14156 pLX_304 0% 76.3% 78.9% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000467933 CGGATACTACGACGTCTTTCTTTA pLX_317 33.9% 76.3% 78.9% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV