Transcript: Mouse NM_001163641.1

Mus musculus SET domain, bifurcated 1 (Setdb1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-04
Taxon:
Mus musculus (mouse)
Gene:
Setdb1 (84505)
Length:
4682
CDS:
186..4112

Additional Resources:

NCBI RefSeq record:
NM_001163641.1
NBCI Gene record:
Setdb1 (84505)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163641.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000305600 TGCTATCTGGGAACCATATTG pLKO_005 907 CDS 100% 13.200 18.480 N Setdb1 n/a
2 TRCN0000092974 CCCATGAGAAACGAACAGTAT pLKO.1 2001 CDS 100% 4.950 6.930 N Setdb1 n/a
3 TRCN0000092975 CCCGAGGCTTTGCTCTTAAAT pLKO.1 3727 CDS 100% 15.000 12.000 N Setdb1 n/a
4 TRCN0000092977 CCAGACATATCGGTCACCTTT pLKO.1 1754 CDS 100% 4.950 3.960 N Setdb1 n/a
5 TRCN0000305551 CACGCCTGGAACCTATGTTTA pLKO_005 1363 CDS 100% 13.200 9.240 N Setdb1 n/a
6 TRCN0000339743 CTAACTCTGGCTACCAGTATA pLKO_005 2521 CDS 100% 13.200 9.240 N Setdb1 n/a
7 TRCN0000339822 TCCCATTTGCCGACCACTAAA pLKO_005 1118 CDS 100% 13.200 9.240 N Setdb1 n/a
8 TRCN0000339821 TGATGACAGCTCTGATGATAA pLKO_005 2945 CDS 100% 13.200 9.240 N Setdb1 n/a
9 TRCN0000305552 TGGCACAAAGGCACCCTTATT pLKO_005 822 CDS 100% 13.200 9.240 N Setdb1 n/a
10 TRCN0000092973 GCCTTGATCTTCCATGTCATT pLKO.1 4451 3UTR 100% 4.950 3.465 N Setdb1 n/a
11 TRCN0000323590 GCCTTGATCTTCCATGTCATT pLKO_005 4451 3UTR 100% 4.950 3.465 N Setdb1 n/a
12 TRCN0000092976 CCACATTGAAAGTGTGGAGAA pLKO.1 2813 CDS 100% 0.405 0.284 N Setdb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163641.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10231 pDONR223 100% 27.2% 27.8% None (many diffs) n/a
2 ccsbBroad304_10231 pLX_304 11.1% 27.2% 27.8% V5 (many diffs) n/a
Download CSV