Transcript: Mouse NM_001163675.1

Mus musculus ATP-binding cassette, sub-family C (CFTR/MRP), member 4 (Abcc4), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Abcc4 (239273)
Length:
5711
CDS:
222..4070

Additional Resources:

NCBI RefSeq record:
NM_001163675.1
NBCI Gene record:
Abcc4 (239273)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163675.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000252074 GGTATACTTCAGACGGAATTA pLKO_005 3962 CDS 100% 13.200 18.480 N Abcc4 n/a
2 TRCN0000252072 TCGTTAGAGTCACCGACTTTA pLKO_005 4987 3UTR 100% 13.200 18.480 N Abcc4 n/a
3 TRCN0000252071 AGATCTTGACAACCGAAATTG pLKO_005 3397 CDS 100% 13.200 10.560 N Abcc4 n/a
4 TRCN0000252073 TTCTCGTCACTGCGGAGTAAA pLKO_005 864 CDS 100% 13.200 10.560 N Abcc4 n/a
5 TRCN0000252070 CCTTAACAAAGGCAATCATAA pLKO_005 328 CDS 100% 13.200 9.240 N Abcc4 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 68 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163675.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488469 GAGGGTGCTGTAACAACCAGAGTC pLX_317 7.1% 78.7% 84% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV