Transcript: Mouse NM_001163776.1

Mus musculus transmembrane protease, serine 3 (Tmprss3), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tmprss3 (140765)
Length:
2878
CDS:
130..1557

Additional Resources:

NCBI RefSeq record:
NM_001163776.1
NBCI Gene record:
Tmprss3 (140765)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163776.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032264 CCCAACTCTGAAGAGAACTTT pLKO.1 1171 CDS 100% 5.625 3.938 N Tmprss3 n/a
2 TRCN0000032265 CCATTCATCTTTCAAGTGTAT pLKO.1 432 CDS 100% 4.950 3.465 N Tmprss3 n/a
3 TRCN0000032266 GCCTGGAGTCTATACGCGAAT pLKO.1 1482 CDS 100% 4.050 2.835 N Tmprss3 n/a
4 TRCN0000032267 TCACCTCTTGTCAGATGACAA pLKO.1 714 CDS 100% 0.495 0.347 N Tmprss3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163776.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12477 pDONR223 100% 80.8% 84.8% None (many diffs) n/a
2 ccsbBroad304_12477 pLX_304 0% 80.8% 84.8% V5 (many diffs) n/a
3 TRCN0000478110 AAAACCCTTACACCGGTATCAACT pLX_317 28% 80.8% 84.8% V5 (many diffs) n/a
Download CSV