Transcript: Mouse NM_001163792.1

Mus musculus family with sequence similarity 76, member A (Fam76a), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Fam76a (230789)
Length:
2971
CDS:
114..950

Additional Resources:

NCBI RefSeq record:
NM_001163792.1
NBCI Gene record:
Fam76a (230789)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000129419 GAGTACCAGCAGGAGAGTAAA pLKO.1 243 CDS 100% 13.200 9.240 N FAM76A n/a
2 TRCN0000278897 GAGTACCAGCAGGAGAGTAAA pLKO_005 243 CDS 100% 13.200 9.240 N FAM76A n/a
3 TRCN0000178300 GCTCAGAATGTACAGTTGTAT pLKO.1 288 CDS 100% 5.625 3.938 N Fam76a n/a
4 TRCN0000200260 CCCTGTTGTGAAGTGTACCTA pLKO.1 212 CDS 100% 3.000 2.100 N Fam76a n/a
5 TRCN0000198470 GAAGGATCAAATGATCCTAGA pLKO.1 728 CDS 100% 0.405 0.284 N Fam76a n/a
6 TRCN0000198149 CAGAAGGATCAAATGATCCTA pLKO.1 726 CDS 100% 0.300 0.210 N Fam76a n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163792.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05182 pDONR223 100% 82.4% 88.9% None (many diffs) n/a
2 ccsbBroad304_05182 pLX_304 0% 82.4% 88.9% V5 (many diffs) n/a
3 TRCN0000473578 AGACAATCCTCTACTTCCCTGTGC pLX_317 50.3% 82.4% 88.9% V5 (many diffs) n/a
Download CSV