Transcript: Mouse NM_001164071.1

Mus musculus TRAF family member-associated Nf-kappa B activator (Tank), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Tank (21353)
Length:
2227
CDS:
367..1611

Additional Resources:

NCBI RefSeq record:
NM_001164071.1
NBCI Gene record:
Tank (21353)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000054847 GCATCACGAAAGGGATAATAT pLKO.1 756 CDS 100% 15.000 21.000 N Tank n/a
2 TRCN0000301536 GCATCACGAAAGGGATAATAT pLKO_005 756 CDS 100% 15.000 21.000 N Tank n/a
3 TRCN0000054844 CGGCATCTTAATACACACTTT pLKO.1 1576 CDS 100% 4.950 6.930 N Tank n/a
4 TRCN0000301535 CGGCATCTTAATACACACTTT pLKO_005 1576 CDS 100% 4.950 6.930 N Tank n/a
5 TRCN0000054843 CGTACAGAGAATAACAGACAA pLKO.1 1988 3UTR 100% 4.950 3.960 N Tank n/a
6 TRCN0000301463 CGTACAGAGAATAACAGACAA pLKO_005 1988 3UTR 100% 4.950 3.960 N Tank n/a
7 TRCN0000054845 CCCAGGCTAAAGATGATATAA pLKO.1 950 CDS 100% 15.000 10.500 N Tank n/a
8 TRCN0000301537 CCCAGGCTAAAGATGATATAA pLKO_005 950 CDS 100% 15.000 10.500 N Tank n/a
9 TRCN0000054846 CCATCCTTTATAGTGATGCTA pLKO.1 332 5UTR 100% 3.000 2.100 N Tank n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164071.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07531 pDONR223 100% 84.5% 79.5% None (many diffs) n/a
2 ccsbBroad304_07531 pLX_304 0% 84.5% 79.5% V5 (many diffs) n/a
3 TRCN0000481327 TCACTCCACTAATATAAGTACCTC pLX_317 22.2% 84.5% 79.5% V5 (many diffs) n/a
Download CSV