Transcript: Human NM_001164116.2

Homo sapiens Cas scaffold protein family member 4 (CASS4), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-06-02
Taxon:
Homo sapiens (human)
Gene:
CASS4 (57091)
Length:
4297
CDS:
302..2662

Additional Resources:

NCBI RefSeq record:
NM_001164116.2
NBCI Gene record:
CASS4 (57091)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164116.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430287 AGAGGCGGTTACAGCACATTA pLKO_005 983 CDS 100% 13.200 18.480 N CASS4 n/a
2 TRCN0000428475 AGAGTCAGGTATGAGGTAAAG pLKO_005 2856 3UTR 100% 10.800 15.120 N CASS4 n/a
3 TRCN0000159042 GAACACTCTTCTGAACTATTA pLKO.1 2204 CDS 100% 13.200 9.240 N CASS4 n/a
4 TRCN0000137733 GCAGAACACCAAGCCCAATAT pLKO.1 1327 CDS 100% 13.200 9.240 N CASS4 n/a
5 TRCN0000160449 CCTTCCAGAAATTCCTTCTTA pLKO.1 1216 CDS 100% 5.625 3.938 N CASS4 n/a
6 TRCN0000136720 CCAGAAGACATCAAGAGGTTT pLKO.1 2009 CDS 100% 4.950 3.465 N CASS4 n/a
7 TRCN0000163816 CCAGGGCACTTTATGACAACT pLKO.1 348 CDS 100% 4.950 3.465 N CASS4 n/a
8 TRCN0000138824 GAAGTGGAGATTCCGAGACTA pLKO.1 1693 CDS 100% 4.950 3.465 N CASS4 n/a
9 TRCN0000155836 CCCAAAGTGCTGGGATTACAA pLKO.1 3641 3UTR 100% 5.625 2.813 Y KLHL30 n/a
10 TRCN0000141025 CCCAAAGTGCTGGGATTACTT pLKO.1 3641 3UTR 100% 5.625 2.813 Y EID2B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164116.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12326 pDONR223 100% 84.7% 82.4% None (many diffs) n/a
2 ccsbBroad304_12326 pLX_304 0% 84.7% 82.4% V5 (many diffs) n/a
3 TRCN0000479325 TTCCAGAAATAACCTAGAAACCGC pLX_317 21.3% 84.7% 82.4% V5 (many diffs) n/a
Download CSV