Transcript: Mouse NM_001164223.1

Mus musculus replication protein A1 (Rpa1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Rpa1 (68275)
Length:
3121
CDS:
126..2060

Additional Resources:

NCBI RefSeq record:
NM_001164223.1
NBCI Gene record:
Rpa1 (68275)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000071280 CGCATGATCTTATCGGCAAAT pLKO.1 1752 CDS 100% 10.800 15.120 N Rpa1 n/a
2 TRCN0000302172 CGCATGATCTTATCGGCAAAT pLKO_005 1752 CDS 100% 10.800 15.120 N Rpa1 n/a
3 TRCN0000311078 CTTCCGGCTTTGTCGGATTTC pLKO_005 2299 3UTR 100% 10.800 15.120 N Rpa1 n/a
4 TRCN0000071281 CGTTGGATTAAAGATTGGGAA pLKO.1 509 CDS 100% 2.640 2.112 N Rpa1 n/a
5 TRCN0000071279 GCCCTGAAGATCGCTAACAAA pLKO.1 996 CDS 100% 5.625 3.938 N Rpa1 n/a
6 TRCN0000302173 GCCCTGAAGATCGCTAACAAA pLKO_005 996 CDS 100% 5.625 3.938 N Rpa1 n/a
7 TRCN0000071282 CGCGAACATCAGGAAGAACAT pLKO.1 2036 CDS 100% 4.950 3.465 N Rpa1 n/a
8 TRCN0000302249 CGCGAACATCAGGAAGAACAT pLKO_005 2036 CDS 100% 4.950 3.465 N Rpa1 n/a
9 TRCN0000304604 AGCTATGAAGATTCGATTAAA pLKO_005 1188 CDS 100% 15.000 9.000 N Rpa1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164223.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10443 pDONR223 100% 80.9% 81.6% None (many diffs) n/a
2 ccsbBroad304_10443 pLX_304 0% 80.9% 81.6% V5 (many diffs) n/a
3 TRCN0000467807 GTATTAAGTAACAAAGCAAAACAT pLX_317 26.8% 80.9% 81.6% V5 (many diffs) n/a
Download CSV