Transcript: Mouse NM_001164224.1

Mus musculus alveolar soft part sarcoma chromosome region, candidate 1 (human) (Aspscr1), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Aspscr1 (68938)
Length:
1588
CDS:
107..1465

Additional Resources:

NCBI RefSeq record:
NM_001164224.1
NBCI Gene record:
Aspscr1 (68938)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164224.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000285931 TAACATCACCTTCGGCCAATT pLKO_005 705 CDS 100% 10.800 7.560 N Aspscr1 n/a
2 TRCN0000277300 TTGCCAACCTGCCTAACAATG pLKO_005 75 5UTR 100% 10.800 7.560 N Aspscr1 n/a
3 TRCN0000181323 CCAAACCAACGGATGCTCAAA pLKO.1 588 CDS 100% 4.950 3.465 N Aspscr1 n/a
4 TRCN0000181657 GCCACCATCAGGTTTGTCATA pLKO.1 371 CDS 100% 4.950 3.465 N Aspscr1 n/a
5 TRCN0000277301 GCCACCATCAGGTTTGTCATA pLKO_005 371 CDS 100% 4.950 3.465 N Aspscr1 n/a
6 TRCN0000181940 GCATCCAGTAGCACATTGCTT pLKO.1 482 CDS 100% 3.000 2.100 N Aspscr1 n/a
7 TRCN0000285934 GCATCCAGTAGCACATTGCTT pLKO_005 482 CDS 100% 3.000 2.100 N Aspscr1 n/a
8 TRCN0000181564 GCCTGAGAACATAGTTCGCAT pLKO.1 136 CDS 100% 2.640 1.848 N Aspscr1 n/a
9 TRCN0000285936 GCCTGAGAACATAGTTCGCAT pLKO_005 136 CDS 100% 2.640 1.848 N Aspscr1 n/a
10 TRCN0000197994 CAGATGAAGGAGAAACTGGAA pLKO.1 1001 CDS 100% 2.640 1.584 N Aspscr1 n/a
11 TRCN0000198863 GCCTTACAGAACACAACCCTT pLKO.1 323 CDS 100% 2.640 1.584 N Aspscr1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164224.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.