Transcript: Mouse NM_001164402.1

Mus musculus protein tyrosine phosphatase, receptor type, O (Ptpro), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Ptpro (19277)
Length:
4180
CDS:
397..1614

Additional Resources:

NCBI RefSeq record:
NM_001164402.1
NBCI Gene record:
Ptpro (19277)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000220469 GCGCTCATACCGAATGTCAAT pLKO.1 1476 CDS 100% 4.950 6.930 N Ptpro n/a
2 TRCN0000220468 CGATTCTTACATCAAGGATAT pLKO.1 732 CDS 100% 10.800 8.640 N Ptpro n/a
3 TRCN0000437475 GCCAAGGACTCGGACTATAAA pLKO_005 754 CDS 100% 15.000 10.500 N Ptpro n/a
4 TRCN0000220467 CCAGAGTTGATTCAACAGTTT pLKO.1 2378 3UTR 100% 4.950 3.465 N Ptpro n/a
5 TRCN0000220470 CCATTCACAGAAGAACCCATT pLKO.1 1117 CDS 100% 4.050 2.835 N Ptpro n/a
6 TRCN0000220471 CCTACAACAGAAGTCCCACAT pLKO.1 1038 CDS 100% 4.050 2.835 N Ptpro n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164402.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01345 pDONR223 100% 29.4% 31.7% None (many diffs) n/a
2 ccsbBroad304_01345 pLX_304 0% 29.4% 31.7% V5 (many diffs) n/a
3 TRCN0000477482 ATTAACTGTCTATCAACCTAGATC pLX_317 13% 29.4% 31.7% V5 (many diffs) n/a
Download CSV