Transcript: Mouse NM_001164466.1

Mus musculus dihydropyrimidinase (Dpys), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Dpys (64705)
Length:
2110
CDS:
109..1668

Additional Resources:

NCBI RefSeq record:
NM_001164466.1
NBCI Gene record:
Dpys (64705)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164466.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000032588 CGCTGTGAACTGCCCTTTATA pLKO.1 822 CDS 100% 15.000 21.000 N Dpys n/a
2 TRCN0000032585 GCACATGCAATTCCCGTTCAT pLKO.1 312 CDS 100% 4.950 6.930 N Dpys n/a
3 TRCN0000032586 CCGAATACATTTACAAACGAA pLKO.1 1514 CDS 100% 3.000 4.200 N Dpys n/a
4 TRCN0000032584 CGATCCTTTAACACCTGGCTT pLKO.1 1017 CDS 100% 2.640 2.112 N Dpys n/a
5 TRCN0000032587 CGCCGAGAATGGAGATTTGAT pLKO.1 684 CDS 100% 5.625 3.938 N Dpys n/a
6 TRCN0000046747 TGTGGCAGTTACCAGCACAAA pLKO.1 1230 CDS 100% 4.950 3.465 N DPYS n/a
7 TRCN0000046746 GTGACTATTTCAAGAGGCAAA pLKO.1 1423 CDS 100% 4.050 2.835 N DPYS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164466.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00460 pDONR223 100% 85.8% 88.4% None (many diffs) n/a
2 ccsbBroad304_00460 pLX_304 0% 85.8% 88.4% V5 (many diffs) n/a
3 TRCN0000472173 GGCGCAGTCATACATCTACTTTAC pLX_317 31.3% 85.8% 88.4% V5 (many diffs) n/a
Download CSV