Construct: ORF TRCN0000472173
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014023.1_s317c1
- Derived from:
- ccsbBroadEn_00460
- DNA Barcode:
- GGCGCAGTCATACATCTACTTTAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DPYS (1807)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472173
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 1807 | DPYS | dihydropyrimidinase | NM_001385.3 | 100% | 100% | |
| 2 | human | 1807 | DPYS | dihydropyrimidinase | XM_005250818.3 | 93.5% | 93.5% | 1233_1340del |
| 3 | human | 1807 | DPYS | dihydropyrimidinase | XM_024447087.1 | 93.5% | 93.5% | 1233_1340del |
| 4 | human | 1807 | DPYS | dihydropyrimidinase | XM_011516903.3 | 86.6% | 86.6% | 1233_1340del;1551_1552ins114 |
| 5 | human | 1807 | DPYS | dihydropyrimidinase | XM_006716518.3 | 83.9% | 83.9% | 262_263ins159;1074_1181del |
| 6 | human | 1807 | DPYS | dihydropyrimidinase | XM_017013167.2 | 82.5% | 80.3% | (many diffs) |
| 7 | human | 1807 | DPYS | dihydropyrimidinase | XR_001745490.2 | 62.7% | 1_154del;1388_1724del;2049_2480del | |
| 8 | human | 1807 | DPYS | dihydropyrimidinase | XR_001745489.1 | 60.1% | 1_154del;1388_1832del;2157_2588del | |
| 9 | mouse | 64705 | Dpys | dihydropyrimidinase | NM_001164466.1 | 85.8% | 88.4% | (many diffs) |
| 10 | mouse | 64705 | Dpys | dihydropyrimidinase | NM_022722.3 | 85.8% | 88.4% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1623
- ORF length:
- 1557
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggcgccctcg cggctcctga tccgcggggg tcgcgtggtc aacgatgact 121 tctcggaggt ggccgacgtg ctggtggagg acggcgtggt gcgggcactc gggcacgacc 181 tgctgcctcc cgggggcgct cctgcggggc tgcgggtcct cgacgccgcc ggcaagctcg 241 tcctgcccgg aggcatcgac acacacacgc acatgcagtt ccccttcatg ggctcgcggt 301 ccatcgacga cttccaccag ggcaccaagg ctgctctctc aggaggcacc accatgatta 361 ttgatttcgc cattcctcag aaaggtggct ccctcattga ggccttcgag acctggcgaa 421 gctgggctga tcccaaagtt tgctgcgact acagccttca tgtggcagtg acgtggtgga 481 gtgaccaggt taaagaagaa atgaaaatcc ttgtgcaaga taaaggtgtt aactctttca 541 agatgtttat ggcctataaa gatctgtaca tggtgacaga cctggagctg tacgaagcct 601 tctctcggtg caaggaaatt ggagcaattg cccaggtcca tgcggaaaat ggagacttaa 661 ttgcagaggg agcaaagaag atgttggctc tggggataac aggccctgag ggccacgagc 721 tgtgccgccc agaggcagtg gaggcagagg ccacgctgag agccatcacc atagccagcg 781 ctgtgaactg tcctctctac attgtgcatg tgatgagcaa gtctgcagct aaggtgatag 841 cggatgcaag gagagatggg aaggtggtct atggtgaacc catagcagcc agtcttggca 901 cagatggcac tcactactgg aataaagaat ggcaccatgc agcccaccat gtcatgggtc 961 cacctttgcg accagacccc tcaacacccg acttcctcat gaatctgttg gctaatgatg 1021 atctaaccac aacagggact gataactgca ctttcaacac ctgccagaaa gctcttggga 1081 aggatgattt taccaagatc cccaatgggg tgaatggtgt tgaagatcgg atgtccgtaA 1141 TATGGGAAAA AGGCGTGCAT AGTGGTAAAA TGGATGAAAA CAGATTTGTG GCAGTTACCA 1201 GCACAAATGC AGCCAAAATT TTTAATCTCT ATCCAAGAAA AGGAAGAATA GCTGTAGGAT 1261 CAGATGCTGA CATTGTTATT TGGGACCCAA AAGGCACAAG GACTATCTCA GCAAAAACTC 1321 ATCATCAGGC TGTTAACTTC AACATTTTCG AGGGCATGGT TTGCCACGGG GTGCCCCTTG 1381 TGACTATTTC AAGAGGCAAA GTGGTATATG AAGCCGGAGT GTTCAGTGTC ACGGCAGGAG 1441 ATGGGAAGTT TATTCCTCGA AAACCATTTG CTGAATATAT TTACAAACGA ATAAAGCAGC 1501 GAGACCGGAC TTGCACACCT ACCCCTGTGG AGCGTGCACC CTATAAGGGA GAAGTCGCCA 1561 CACTGAAATC CAGAGTGACA AAAGAAGATG CCACAGCAGG GACCAGGAAA CAGGCCCACC 1621 CCTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1681 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1741 GGCTTTATAT ATCTTGTGGA AAGGACGAGG CGCAGTCATA CATCTACTTT ACACGCGTTA 1801 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt