Transcript: Human NM_001164541.2

Homo sapiens DISC1 scaffold protein (DISC1), transcript variant e, mRNA.

Source:
NCBI, updated 2019-09-10
Taxon:
Homo sapiens (human)
Gene:
DISC1 (27185)
Length:
2929
CDS:
79..2166

Additional Resources:

NCBI RefSeq record:
NM_001164541.2
NBCI Gene record:
DISC1 (27185)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000118997 CCGAGGAGATTAGATCATTAA pLKO.1 1901 CDS 100% 13.200 6.600 Y DISC1 n/a
2 TRCN0000118998 GAGACGTTACAACAAAGATTA pLKO.1 1198 CDS 100% 13.200 6.600 Y DISC1 n/a
3 TRCN0000119000 GCAGTTGAGAATGATGATTAT pLKO.1 1168 CDS 100% 13.200 6.600 Y DISC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164541.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08070 pDONR223 100% 83.4% 79.4% None 791G>A;1980_1981ins61;2085_2086ins350 n/a
2 ccsbBroad304_08070 pLX_304 0% 83.4% 79.4% V5 791G>A;1980_1981ins61;2085_2086ins350 n/a
3 TRCN0000477691 ATACGATCGAGTTAACGTCAACCC pLX_317 15.6% 83.4% 79.4% V5 791G>A;1980_1981ins61;2085_2086ins350 n/a
Download CSV