Transcript: Mouse NM_001164663.1

Mus musculus suppressor of glucose, autophagy associated 1 (Soga1), mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Soga1 (320706)
Length:
13232
CDS:
357..5321

Additional Resources:

NCBI RefSeq record:
NM_001164663.1
NBCI Gene record:
Soga1 (320706)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001164663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000376211 AGCCGGTGGCTTTGCAATTTC pLKO_005 4248 CDS 100% 13.200 9.240 N Soga1 n/a
2 TRCN0000376210 ATGGGCTTTCTAGCCTCTTTA pLKO_005 4810 CDS 100% 13.200 9.240 N Soga1 n/a
3 TRCN0000367027 GCTGAACGAGCTGGCCAAATA pLKO_005 1964 CDS 100% 13.200 9.240 N Soga1 n/a
4 TRCN0000376157 ACATGGAGGAAGACGTGTATC pLKO_005 1087 CDS 100% 10.800 7.560 N Soga1 n/a
5 TRCN0000377227 GCGAGGAAAGCTGCAAGAAAC pLKO_005 4981 CDS 100% 10.800 7.560 N Soga1 n/a
6 TRCN0000367029 TGCGTTCCGAGAACGACTATC pLKO_005 1012 CDS 100% 10.800 7.560 N Soga1 n/a
7 TRCN0000367028 TGGACCCAGAACACGCCTAAT pLKO_005 3249 CDS 100% 10.800 7.560 N Soga1 n/a
8 TRCN0000367026 GAGCTTTCACATTAAGGTAAA pLKO_005 5440 3UTR 100% 10.800 6.480 N Soga1 n/a
9 TRCN0000190964 CCTCTCAAGTGCTGGGATTAA pLKO.1 9864 3UTR 100% 13.200 6.600 Y Nop16 n/a
10 TRCN0000155325 GAGATGGACGACATGAAGGAT pLKO.1 1779 CDS 100% 3.000 2.100 N SOGA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164663.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.