Transcript: Human NM_001164738.1

Homo sapiens calcitonin receptor (CALCR), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
CALCR (799)
Length:
3610
CDS:
317..1741

Additional Resources:

NCBI RefSeq record:
NM_001164738.1
NBCI Gene record:
CALCR (799)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001164738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356731 CAACGCTTGCGGTGGTATTAT pLKO_005 1085 CDS 100% 15.000 21.000 N CALCR n/a
2 TRCN0000356795 ATCGAACCTGGTCCAACTATA pLKO_005 690 CDS 100% 13.200 18.480 N CALCR n/a
3 TRCN0000008162 CCAACCACTATCCATGCTATT pLKO.1 1133 CDS 100% 10.800 15.120 N CALCR n/a
4 TRCN0000008161 GCGGCTTTCTAATAGAGAGAT pLKO.1 2273 3UTR 100% 4.950 6.930 N CALCR n/a
5 TRCN0000356796 ATCAGTTCTGCCCAGATTATT pLKO_005 591 CDS 100% 15.000 12.000 N CALCR n/a
6 TRCN0000378105 GGCGGCACTTGTGGTCAATTT pLKO_005 1234 CDS 100% 13.200 10.560 N CALCR n/a
7 TRCN0000008165 CCTATCAGTTCTGCCCAGATT pLKO.1 588 CDS 100% 4.950 3.465 N CALCR n/a
8 TRCN0000008164 CGTAGGACGAAAGAAGATGAT pLKO.1 442 CDS 100% 4.950 3.465 N CALCR n/a
9 TRCN0000008163 CCTTTGAATATCATAGAGCAA pLKO.1 1706 CDS 100% 2.640 1.848 N CALCR n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001164738.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000487724 TGATACTAGCCGTCTCTTTTCCAG pLX_317 22.7% 100% 100% V5 (not translated due to prior stop codon) n/a
Download CSV